Labshake search
Citations for Millipore Sigma :
301 - 350 of 10000+ citations for Tert Butyldimethyl 3 4 4 5 5 Tetramethyl 1 3 2 Dioxaborolan 2 Yl Phenoxy Silane since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: ... with a 3:1 M ratio of 5-norbornene-2-carboxylic acid (mixture of endo and exo isomers; Millipore-Sigma) to HA-TBA repeat units ...
-
bioRxiv - Microbiology 2024Quote: ... Each extract was resuspended in 170 µL of 100% methanol containing isotopically labeled internal standards (5-50 µM of 13C,15N Cell Free Amino Acid Mixture, #767964, Sigma; 1 ug/mL 2-amino-3-bromo-5-methylbenzoic acid, ABMBA, #R435902, Sigma) and centrifuge-filtered (0.22 µm hydrophilic PVDF membrane ...
-
bioRxiv - Bioengineering 2021Quote: Before staining with either 5-bromo-4-chloro-3′-indolyphosphate and nitro-blue tetrazolium (BCIP/NBT, Sigma-Aldrich) for alkaline phosphatase (ALP ...
-
bioRxiv - Developmental Biology 2021Quote: ... and color was developed with 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT; Sigma). Following color development ...
-
bioRxiv - Neuroscience 2022Quote: ... AMPA (α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid) receptors were blocked using 6,7-dinitroquinoxaline-2,3-dione (DNQX, Sigma) dissolved in dimethyl sulfoxide and diluted by 1000 in aCSF for 10μM bath application.
-
bioRxiv - Microbiology 2022Quote: ... Membranes were developed using 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) (Sigma Aldrich, 11697471001 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Bands were stained in 5-bromo-4-chloro-3-indolyl-phosphate and nitro blue tetrazolium solution (Sigma-Aldrich). The membrane image was acquired using a digital steel camera EOS M6 mark II with a lens EF16-35 mm F4L IS USM (Canon Inc. ...
-
bioRxiv - Microbiology 2023Quote: ... 5 × 10−5 M 2-mercaptoethanol (Sigma), and 1% penicillin-streptomycin ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μM 4-hydroxy tamoxifen (4-HT; Sigma) was added at the time of activation.
-
bioRxiv - Neuroscience 2020Quote: The cell viability was determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich; Merck KGaA) assay ...
-
bioRxiv - Cancer Biology 2021Quote: ... cell viability was determined using the 3-(4,5-dimethylthiazol-2- yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich, Milan, Italy) according to the manufacturer’s instruction.
-
bioRxiv - Cancer Biology 2020Quote: ... Viability was evaluated with a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide (MTT) colorimetric assay (Sigma, #M5655).
-
bioRxiv - Physiology 2022Quote: Cell viability was measured by the colorimetric assay showing reduction of MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) (Sigma-Aldrich) as previously described (Denizot and Lang ...
-
bioRxiv - Microbiology 2022Quote: ... Cell viability was determined by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) to MTT formazan conversion assay (Sigma-Aldrich) as described [29].
-
bioRxiv - Bioengineering 2020Quote: ... This assay relies on the reduction and conversion of yellow 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium-bromide (MTT) reagent (#M2128, Sigma-Aldrich) into purple formazan salt ...
-
bioRxiv - Microbiology 2022Quote: ... Cell viability was determined by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) to MTT formazan conversion assay (Sigma-Aldrich), as described (60) ...
-
bioRxiv - Molecular Biology 2023Quote: The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium Bromide (MTT) cell growth kit (CT02, Millipore, MA, USA) was used for measuring cell viability ...
-
bioRxiv - Microbiology 2023Quote: The effect of drug treatments on cell viability was assessed using the MTT [3-(4,5- dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide] assay (the MTT powder was obtained from Sigma Aldrich). VTN or Huh-7 cells were seeded the day before treatment at a concentration of 7L×L103 cells per well in DMEM supplemented with 10% FBS and 1% Pen/Strep ...
-
bioRxiv - Neuroscience 2024Quote: ... cells grown in 96-well plates were treated with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Sigma, Hungary) in a final concentration of 200 μg/ml ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and MTT reagent (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) were purchased from Sigma-Aldrich (St Louis, MO). Phalloidin-iFluor 594 was purchased from Abcam ...
-
bioRxiv - Plant Biology 2022Quote: ... After addition of 10μl of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) solution (5mg/ml, Sigma-Aldrich, USA) the cells were incubated in darkness for another 4 hrs ...
-
bioRxiv - Microbiology 2022Quote: The effect of CAPG depletion on viability of KO and siRNA-treated cells was assessed at several timepoints using a 3-[4,5-dimethylthiazol-2-yl]-2,5 diphenyl tetrazolium bromide (MTT) assay (11465007001; Sigma-Aldrich) per manufacturer directions ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.5mg/ml of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich®, St Louis, MO, USA) was added and incubated at 37°C for 3h ...
-
bioRxiv - Microbiology 2023Quote: ... Cell viability was determined by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) to MTT formazan conversion assay (Sigma-Aldrich), as described (Pizzato Scomazzon et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl benzonase (Millipore, 71206-3) was added ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’, Sigma Aldrich). The siRNA for luciferase (siLuc ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’, Sigma Aldrich), siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8A (5’-GACAAGUUUCCAAGGAACGtt-3’, Sigma Aldrich), siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’, Sigma Aldrich), siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... or Tim29 (5’ GGCUCUUCGAUGAGAAGUA 3’) (Sigma). Briefly ...
-
bioRxiv - Immunology 2020Quote: ... with 3 mg 5-fluorouracil (Sigma). Bone marrow was collected after 4 days and cultured in DMEM containing 15% FBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... or 5 mM 3-MA (Sigma) were added during the 16-h incubation period ...
-
bioRxiv - Cell Biology 2023Quote: ... siSpindly (Sigma-Aldrich, 5′-GAAAGGGUCUCAAACUGAA-3′) for 48 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... siTTLL12_6: 5’- GGUUGUUCGUGUAUGAUGU-3’ (Sigma-Proligo).
-
bioRxiv - Biochemistry 2024Quote: ... K125E reverse: 5’-ttcgatgcggacctcctgggttttgatctc-3’ (Sigma) with the wild-type human connexin 26 pFast construct used for previous studies as the template for mutagenesis (Brotherton et al. ...
-
bioRxiv - Microbiology 2024Quote: ... Rev: 5’ TGTCCGTGAGCCTTCCTGTTTCCCACAGCGTCC 3’ (Sigma-Aldrich). RNA was generated from linearized DNA by in vitro transcription and transfected into BHK21 cells using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Biochemistry 2024Quote: ... siCENP-H (Sigma, 5′-CUAGUGUGCUCAUGGAUAA-3′) (64) ...
-
bioRxiv - Biochemistry 2024Quote: ... siCENP-I (Sigma, 5′-AAGCAACTCGAAGAACATCTC-3′) (107) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and CTNNB1: 5’- CUCAGAUGGUGUCUGCUAU-3’ (Sigma). A complete list of antibodies is provided in Supplemental Table 2.
-
bioRxiv - Cell Biology 2024Quote: ... human ZBP1: 5’-CGGTAAATCGTCCATGCTT-3’ (Sigma). The gRNAs were cloned into pSpCas9n(BB)-2A-GFP plasmid (PX461 ...
-
bioRxiv - Cell Biology 2022Quote: ... 3-isobutyl-1-methylxanthine (0.5 mM; Sigma, 28822-58-4), indomethacin (200 μM ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 ng/mL interleukin-4 (IL-4, Sigma-Aldrich) and 0.5 μg/mL anti-CD180 (BD PharMingen) ...
-
bioRxiv - Neuroscience 2022Quote: ... samples were incubated for 5 min with a 4’,6-diamidino-2-phenylindole (DAPI) solution (Sigma) to stain cell nuclei ...
-
bioRxiv - Physiology 2024Quote: ... samples were incubated with 5 µg/mL 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI, Sigma-Aldrich) in PBS ...
-
bioRxiv - Immunology 2021Quote: The livers of freshly-sacrificed mice were perfused retrogradely via the IVC(3) with 3 ml of PBS and then 10 ml of 2% paraformaldehyde (Sigma, catalogue# 30525-89-4) in PBS ...
-
bioRxiv - Microbiology 2024Quote: ... HEK 293FT cells were transfected with 1μg of TRC-pLKO.1-Puro plasmid containing either non-targeting shRNA (5’-CAACAAGATGAAGAGCACCAA-3’) or ATF4-targeted shRNA (5’-GCCTAGGTCTCTTAGATGATT-3’) (Sigma-Aldrich), together with 1 μg mixture of packaging plasmids (pMD2.G and psPAX2 ...
-
bioRxiv - Plant Biology 2021Quote: ... lapachol (2-hydroxy-3-(3-methyl-2-butenyl)-1,4-naphthoquinone) were purchased from Sigma-Aldrich. Vismione H and madagascine were obtained from PGE2 fraction of Psorospermum glaberimum as previously described (Gallé ...
-
bioRxiv - Genetics 2021Quote: ... was propagated and maintained by transferring shoot segments of 3-4 cm with 1-2 young leaves to fresh one-half Murashige and Skoog (Beijing, China, Sigma-Aldrich). Plantlets were grown at 23 ℃ under a 16 h light/8 h dark cycle with a light intensity of illumination of 5000 lux provided by cool white fluorescent lamp tubes ...
-
bioRxiv - Microbiology 2022Quote: ... 3-(N-Morpholino)propanesulfonic acid (MOPS) or 4-(2-hydroxyethyl)-1- piperazineethanesulfonic acid (HEPES) buffer (all purchased from Sigma-Aldrich, USA). Macrocolonies were excised and resuspended in 2 mL of sterile 1X PBS ...
-
bioRxiv - Immunology 2024Quote: ... 5 mM 2-hydrocycitrate (2-HC) (Sigma) was added to cell culture at indicated time points ...