Labshake search
Citations for Millipore Sigma :
451 - 500 of 10000+ citations for Tert Butyldimethyl 3 4 4 5 5 Tetramethyl 1 3 2 Dioxaborolan 2 Yl Phenoxy Silane since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Chk1 (3’Chk1) (5’CUGGUGAAUAUAGUGCUGCUA3’ from Sigma-Aldrich), Polι (SMART pool ...
-
bioRxiv - Plant Biology 2022Quote: ... supplemented with 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich) and 0 mM ...
-
bioRxiv - Microbiology 2024Quote: ... or 2 mM tert-butyl hydroperoxide (TBOOH, Sigma). Nunc 96-well EdgeTM plates (ThermoFisher ...
-
bioRxiv - Neuroscience 2020Quote: ... The cells were centrifuged for 5 min at 700g and treated for 10 min with DAPI (4’,6-diamidino-2-phenylindole) (1:4000, Sigma, 62248) to label dead cells ...
-
bioRxiv - Microbiology 2023Quote: ... Washed beads were adjusted to pH 7.5 with 200 mM HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) and bound proteins were reduced using 5 mM dithiothreitol (Sigma-Aldrich) at 37°C for 1 h ...
-
bioRxiv - Cell Biology 2020Quote: ... Tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine (TBTA) (Sigma). The reaction was allowed to proceed for 1 hour ...
-
bioRxiv - Neuroscience 2021Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; 1:1000; Sigma) was added to the cell suspension ...
-
bioRxiv - Neuroscience 2021Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, 1:1000, Sigma) was used to show nuclei clear and dyed for 5 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... 4′,6′-diamidino-2-phenylindole (1:3000; Sigma-Aldrich) was used to counterstain sections and coverslips were mounted using Fluorogel l (Electron Microscopy Sciences ...
-
bioRxiv - Neuroscience 2022Quote: ... propyl acetate and 3-methyl-2-buten-1-ol (Sigma). Odorants were selected based on previous work using this task (Gu & Li ...
-
bioRxiv - Cell Biology 2021Quote: ... 1/100 Phosphatase Inhibitor Cocktail 2 and 3 (Sigma Aldrich). Per condition ...
-
bioRxiv - Microbiology 2021Quote: ... rabbit anti-Akt 1/2/3 antibody (Millipore, Burlington, MA), rabbit anti-MAPK family antibodies (Cell Signaling Technologies ...
-
bioRxiv - Neuroscience 2021Quote: Metyrapone (2-Methyl-1,2-di-3-pyridyl-1-propane; Sigma), a steroid 11β-inhibitor ...
-
bioRxiv - Immunology 2021Quote: ... 1-palmitoyl-2- arachidonoyl-sn-glycero-3-phosphocholine (PAPC, Sigma), oxPAPC (oxidized PAPC ...
-
bioRxiv - Neuroscience 2023Quote: ... and 1:100 phosphatase inhibitor cocktail 2 & 3 (Sigma-Aldrich) as previously reported [27 ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM 2-Imino-1-imidazolidineacetic acid (cyclocreatine, Sigma-Aldrich), 50 µM NG,NG-Dimethylarginine dihydrochloride (ADMA ...
-
bioRxiv - Developmental Biology 2020Quote: ... and then incubated with nitro blue tetrazolium chloride/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) substrates (Sigma-Aldrich) in NTM (100mM NaCl ...
-
bioRxiv - Biochemistry 2020Quote: ... and the blotting signals were chemically visualized with either the nitro-blue tetrazolium/5-bromo-4-chloro-3′-indolyphosphate (NBT/BCIP) chromogenic assay (Sigma) or infrared scanner ...
-
bioRxiv - Genetics 2020Quote: ... Samples were immunoprecipitated with antibodies (5-8 μg) overnight at 4°C followed by incubation for 3 hours with protein G-sepharose beads (Millipore) and washed sequentially ...
-
bioRxiv - Bioengineering 2021Quote: ... we incubated them with suspended lentiviral solutions (MOI 3-5) for 24 h with 4 µg/mL polybrene (Sigma-Aldrich) before we replaced the medium with refresh culture medium ...
-
Identification and biochemical characterization of a novel eukaryotic-like Ser/Thr kinase in E. colibioRxiv - Microbiology 2020Quote: ... coli DH5α cells were transformed with the resulting pho-lac fusion plasmids and streaked on dual indicator plates containing LB agar with 5-bromo-4-chloro-3-indolyl phosphate disodium salt (X-Phos) (Sigma) at a final concentration of 80μg/ml and 6-chloro-3-indolyl-β-D-galactoside (Red-Gal ...
-
bioRxiv - Microbiology 2021Quote: ... Immunoreactive bands were detected by the addition of BCIP (5-bromo-4-chloro-3-indolylphosphate)-nitroblue tetrazolium solution (Sigma-Aldrich). The reaction was stopped after 2 min by washing the blots with large volumes of deionized water.
-
bioRxiv - Bioengineering 2021Quote: ... slides were either treated with SIGMA FAST™ BCIP/NBT (5-Bromo-4-chloro-3-indolulphosphate/Nitro blue tetrazolium, pH 9.5, Sigma) and counterstained with nuclear fast red (Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... mito-tempol[23] (25 μg, Sanbio) and oligodeoxynucleotide (3 μg/μl day 4, 5 and 6 after carrageenan, Sigma-Aldrich), were performed under light isoflurane anesthesia as described.[8a ...
-
bioRxiv - Developmental Biology 2024Quote: ... the samples were incubated in NBT (nitro-tetrazolium blue)-BCIP (5 bromo-4-chloro-3’-indolyphosphate p-toluidine) (Sigma-Aldrich), 0.033% in APTMg in dark condition ...
-
bioRxiv - Microbiology 2023Quote: ... the blots were washed again using TBST and developed using AP-reactive Nitrobluetetrazolium (NBT) 5-bromo-4-chloro-3-indolylphosphate (BCIP) tablets (Sigma). A final image of the blots was taken on a Bio-Rad ChemiDoc gel imaging system using colorimetric detection.
-
bioRxiv - Plant Biology 2022Quote: ... pH 5.5 and 100 μM 3′,5′-dimethoxy-4′-hydroxyacetophenone (acetosyringone) (115540050; Acros Organics, dissolved in dimethyl sulfoxide (DMSO) (D8418; Sigma). The culture was incubated with shaking (120 rpm ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... anti-total-α-amino-3-hydroxy-5-methyl-4-isoxazolepropionate receptor (anti-tAMPAR) (Cat.#AB1504, Merck Millipore, Burlington, MA, USA), anti-phospho (Ser845)-AMPAR (anti-pAMPAR;cat.#AB5849 ...
-
bioRxiv - Neuroscience 2024Quote: ... for 5 minutes and washed 3-4 times in PBS before being mounted in Mowiol mounting media (Millipore, 475904-M).
-
bioRxiv - Systems Biology 2024Quote: ... Cells were cultivated under humidified conditions with 5% CO2 at 37°C and passaged every 3-4 days using 0.05% trypsin/EDTA (Sigma-Aldrich). Cells were harvested in ice-cold PBS buffer using a cell scraper ...
-
bioRxiv - Cancer Biology 2021Quote: Cell viability was determined using a commercial 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) viability assay (Sigma Aldrich, Rehovot, Israel). That assay was used to determine how highly 4T1 proliferation was stimulated by Norepinephrine (NE ...
-
bioRxiv - Neuroscience 2021Quote: Viability of SH-SY5Y cells after treatments with or without H-LIPEF was assessed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich; Merck KGaA) assay ...
-
bioRxiv - Neuroscience 2020Quote: The viability of microglial cells was measured using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma-Aldrich, Steinheim, Germany) assay as described previously [36] ...
-
bioRxiv - Cell Biology 2024Quote: We assessed mitochondrial activity using the 3-(4,5-dimethylthiazol-2-yl-)-2,5-diphenyl-2H-tetrazolium bromide (MTT) assay (Sigma-Aldrich, Cat# M6494). As a tetrazolium dye ...
-
bioRxiv - Cancer Biology 2024Quote: ... After 72 hrs we performed 3-(4,5- dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) assays using the Roche MTT protocol (Sigma Aldrich Cat#11465007001). After 24 hours light absorption at 570 nm was measured using the MTT plate reader (Wallac EnVision 1.12) ...
-
bioRxiv - Microbiology 2021Quote: ... containing 5% 2-mercaptoethanl (Sigma) by incubating the beads at 100°C for 5 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 5% 2-mercaptoethanol (Sigma), and incubated at room temperature instead of boiled ...
-
bioRxiv - Neuroscience 2022Quote: ... containing 5% 2-mercaptoethanol (Sigma) and fractionated by SDS-PAGE using the Mini-PROTEAN Tetra System (Bio-Rad ...
-
bioRxiv - Molecular Biology 2021Quote: ... X0-3 and X0-4 oligonucleotides (Sigma-Aldrich) in a buffer containing 50 mM Tris-HCl (pH 7.5) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3 µM 4-hydroxytamoxifen (OH-Tam, Sigma Aldrich) was added to induce Cre-mediated recombination in the mouse Ctsd gene resulting in a premature stop codon ...
-
bioRxiv - Microbiology 2023Quote: ... 4 mM glyceraldehyde-3-phosphate (G3P; Sigma-Aldrich), 4 mM nicotinamide adenine dinucleotide (NAD+ ...
-
bioRxiv - Neuroscience 2022Quote: ... 4 ng/mL human NT-3 (Sigma-Aldrich), and 1 μg/mL laminin (Fisher Scientific) ...
-
bioRxiv - Neuroscience 2024Quote: ... odors (4-methylcyclohexanol or 3-octanol; Sigma-Aldrich) were delivered through an air-flow that was held stable at 0.750L per minute ...
-
bioRxiv - Bioengineering 2020Quote: ... 2-hydroxy-4’-(2-hydroxyethoxy)-2-methylpropiophenone (Irgacure 2959, 410896, Sigma Aldrich), VEGF specific control aptamer (47-nt ...
-
bioRxiv - Microbiology 2023Quote: ... 3 μl of the reducing reagent (mixture of 0.2 g 1-amino-2-naphtol-4-sulfonic acid (Millipore-Sigma, Burlington, MA, USA, #08751) with 0.2 g sodium bisulfite (Millipore-Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... AKAP220 siRNA (5’-CCAAUGUAAGCA GUAGUCCUCUAA A-3’) and scramble siRNA (5’-UUUAGAGGACUACUGCUUACA UUGG-3’) were from Millipore (Burlington, MA).
-
bioRxiv - Biochemistry 2020Quote: ... Sequences for the HIF1α shRNA (shRNA10819 5’-CCGGTGCTCTTTGTGGTTGGATCTACTCGAGTAGATCCAACCACAAAGAGCATTTTT-3’ and shRNA3809 5’-CCGGCCAGTTATGATTGTGAAGTTACTCGAGTAACTTCACAATCATAACTGGTTTTT-3’) were obtained from Sigma Aldrich. Scrambled shRNA was used as negative controls ...
-
bioRxiv - Molecular Biology 2024Quote: ... two siRNAs targeting this RBP (siPTBP1) were transfected into HeLa cells (siPTBP1_1: 5’- GCACAGUGUUGAAGAUCAU-3’; siPTBP1_2: 5’- AACUUCCAUCAUUCCAGAGAA-3’; Sigma-Aldrich), using the jetPRIME® (Polyplus Transfection ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 μM 5-bromo-2’-deoxyuridine (BrdU, Sigma-Aldrich) was added into the culture medium for 10 h ...
-
bioRxiv - Genomics 2020Quote: ... 5-aza-2’-deoxycytidine (5-aza-dC, Sigma, A3656) was diluted in DMSO at a concentration of 10mM and Abl.1 cells were treated using a concentration range of 10 nM to 20 μM 5-aza-2’-deoxycytidine ...