Labshake search
Citations for Millipore Sigma :
3401 - 3450 of 4532 citations for Human LACC1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... Plasmids were transiently transfected into 293F suspension cells as previously described using polyethyleneimine transfection reagent (Sigma-Aldrich) [25] ...
-
bioRxiv - Cell Biology 2020Quote: ... Plasmids were transfected into U2OS and 293T cells using X-tremeGENE™ 9 DNA Transfection Reagent (Sigma) or HBMEC cells using Lipofectamine 3000 (ThermoFisher ...
-
bioRxiv - Biochemistry 2021Quote: ... 100ng of a plasmid coding for a gene of interest was transfected using PEI transfection reagent (Sigma). Supernatants were collected 24h post-transfection ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... plasmid coding for 6x-His-Cas9 were transformed in Rosetta DE3 Novagen competent cells (Merck Millipore, USA). Protein production was induced using autoinduction medium (Formedium ...
-
bioRxiv - Cell Biology 2020Quote: ... Purification of both protein constructs was similar: plasmid was transformed into the Rosetta2 strain of E.coli (Novagen). Two liters of culture were grown in terrific broth for 8-12h at 37°C (until the OD600 ~2) ...
-
bioRxiv - Molecular Biology 2020Quote: ... An open-reading frame of the truncated Pch2 was PCR-amplified and inserted into pET15b plasmid (Novagen) in which an N-terminus of the PCH2 gene was tagged with hexa-histidine ...
-
bioRxiv - Cell Biology 2022Quote: Cells expressing URA3 plasmids were grown overnight in 1× YNB medium (Sigma Aldrich, St. Louis, MO, USA), containing 1% Ethanol (Boom BV ...
-
bioRxiv - Biochemistry 2022Quote: ... and H3 (residues 38-135) in a pDEST plasmid were expressed in BL21 Rosetta2 (DE3) cells (Novagen) and purified from inclusion bodies as previously described except for minor modifications for the purification of tailless histones(14 ...
-
bioRxiv - Cancer Biology 2024Quote: ... For P30 EPO the plasmid mixture was adjusted to 1:100 with methylene blue dye (Sigma 50484) in PBS in a final volume of 25µl per leg ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified plasmid constructs were used to transform the bacterial expression strain Rosetta™(DE3)pLysS (EMD Millipore). To express protein ...
-
bioRxiv - Neuroscience 2024Quote: A mix of endotoxin-free plasmid preparation (2 mg/mL total concentration) and 0.5% Fast Green (Sigma) was injected into one lateral hemisphere of E15.5 embryos using a Picospritzer III (Parker) ...
-
bioRxiv - Biochemistry 2024Quote: ... and 0.57 µg VSV-G plasmid (pMD2.G) using 26 µL of XtremeGene HP (6366244001, Sigma Millipore) in 1 mL of Optimem (11058-021 ...
-
bioRxiv - Biochemistry 2024Quote: ... and 0.57 µg VSV-G plasmid (pMD2.G) using 26 µL of XtremeGene HP (6366244001, Sigma Millipore) in 1 mL of Optimem (11058-021 ...
-
bioRxiv - Biochemistry 2023Quote: ... Both plasmids (ATAD2/B) were transformed into Escherichia coli BL21(DE3) pLysS competent cells (Novagen, MA, USA) for protein expression.
-
bioRxiv - Neuroscience 2023Quote: ... Embryos were exposed and injected with∼1.5 μl of mixed plasmid DNA with Fast Green (Sigma Aldrich) into the lateral ventricle via a beveled micropipette ...
-
bioRxiv - Bioengineering 2023Quote: ... The product plasmids were then transformed into Rosetta™(DE3)pLysS Competent Cells (Millipore Sigma, Catalog #70956) following the manufacturer’s protocols.
-
bioRxiv - Cancer Biology 2023Quote: ... and renilla plasmid transfection was performed using the GeneJuice transfection reagent following the manufacturer’s instructions (Sigma, 70967). For stable expression of TMEM192-3xHA and TMEM192-2xFLAG ...
-
bioRxiv - Biochemistry 2022Quote: The NKX2-5 homeodomain gene (DNASU Plasmid Repository) was cloned in a pET-51(+) expression vector (Novagen) containing an N-terminal Strep•Tag® and a C-terminal 10X His•Tag® through Gibson Cloning and used to transform BL21 DE3 E ...
-
bioRxiv - Cell Biology 2023Quote: Lentivirus containing a plasmid programmed to express either CMIP-specific sgRNA (ACGTCTTCAATGGCGCTGTAGG, Millipore Sigma, Sanger Clone MM5000005403) or non-targeting control sgRNA (Millipore Sigma ...
-
bioRxiv - Genetics 2023Quote: ... 250–500 ng of labeled plasmid and 12.5–25 μg of sonicated salmon sperm DNA (Sigma-Aldrich) were used per slide ...
-
bioRxiv - Genetics 2023Quote: ... 250–500 ng of labeled plasmid and 12.5–25 μg of sonicated salmon sperm DNA (Sigma-Aldrich) were applied per slide ...
-
bioRxiv - Microbiology 2023Quote: ... parasites containing the episomal plasmids selected with WR99210 were grown with 400 μg/ml Neomycin/G418 (Sigma) to select for transgenic parasites carrying the desired genomic modification as described previously (Birnbaum et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cell lines were transduced with Luc-plasmid using Sigma® MISSION® ExpressMag® Beads (Sigma-Aldrich) and selected under hygromycin antibiotic (Sigma-Aldrich) ...
-
bioRxiv - Biophysics 2023Quote: ... The plasmids were transiently transfected to TMEM16F-KO HEK293T cells using X-tremeGENE9 transfection reagent (Sigma-Aldrich). Cells grew on coverslips coated with poly-L-lysine (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2023Quote: ... coli RIL strains carrying the appropriate plasmid were grown in 1 l Luria-broth (LB) (Merck Millipore) supplemented with kanamycin (100 μg/ml ...
-
bioRxiv - Neuroscience 2023Quote: The pET-28a plasmid expressing the GluK2-LBD construct was transformed into competent OrigamiTM 2 cells (Novagen). Cells were plated out on a Lysogeny Broth (LB ...
-
bioRxiv - Cell Biology 2023Quote: The Cno DIL domain sequence (aa 613-1006) was cloned into plasmid pET28 (Millipore Sigma, Burlington, MA) using PCR and primers with engineered NheI and EcoRI restriction sites ...
-
bioRxiv - Cancer Biology 2023Quote: Bacterial expression plasmids for rFGF19/rAldafermin were transformed into Rosetta-gami™ 2 (DE3) competent cells (Novagen). Bacteria were cultured in LB medium + 100μg/mL ampicillin and induced with 0.2mM IPTG at 30°C for 3h.
-
bioRxiv - Systems Biology 2023Quote: ... cells were transfected with 10µg of library-containing plasmid using X-tremeGENE 9 transfection reagent (Sigma-Aldrich) at a ratio of 3:1 reagent to DNA (30µL transfection reagent for 10µg plasmid ...
-
bioRxiv - Physiology 2024Quote: ... # 58376)27 together with the helper plasmid pDP828 in HEK-293T cells using polyethylenimine (Sigma-Aldrich, Darmstadt, Germany). AAV vectors were purified using iodixanol step gradients and titrated as described.29
-
bioRxiv - Biophysics 2021Quote: ... Micropatterned coverslips were functionalized with a solution of 10 µg mL-1 FN from human plasma (Sigma Aldrich #F1056) for 1 h at room temperature ...
-
bioRxiv - Cancer Biology 2021Quote: ... solutions of 89Zr-labeled TDM1 (4 μCi/μg) were prepared in PBS (pH 7.5) containing 1% w/v human serum albumin (HSA, Sigma) and 0.1% w/v sodium azide (NaN3 ...
-
bioRxiv - Immunology 2021Quote: ... that serves as support for the culture system was prepared seeding human dermal fibroblasts (200,000) re-suspended in a fibrin gel made of fibrinogen (Merck-Millipore), thrombin (Merck-Millipore ...
-
bioRxiv - Molecular Biology 2021Quote: ... TIFs (Telomerase immortalised fibroblasts29) and human embryonic kidney (HEK)293Ts cells were cultured in Dulbecco’s Modified Eagles Medium (DMEM) (D5796, Sigma). All cell culture medium was supplemented with 10% v/v foetal bovine serum (FBS ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1×105 ESCs were plated on a 3.8 cm2 plate coated with human plasma fibronectin (Millipore, cat. no. FC010) and cultured in N2B27 medium supplemented with 12 ng/ml bFGF (R&D Systems ...
-
bioRxiv - Immunology 2022Quote: ... containing 2% (vol/vol) of heat inactivated (HI, for 1h at 56°C) human AB serum (hABS) (Sigma, #H3667). After extensive washings with DPBS (Gibco ...
-
bioRxiv - Immunology 2019Quote: ... and 5 μm sections were prepared and incubated with a mouse anti-human IgG4 mAb (clone MRQ-44; Sigma) or isotype control ...
-
bioRxiv - Synthetic Biology 2019Quote: ... we grew the cells in plastic 48-well plates that were pretreated with 50 μg/mL human fibronectin (Millipore) for at least 10 min at 37 °C before cell plating (to improve cell adherence) ...
-
bioRxiv - Cancer Biology 2019Quote: The AsPC-1 and Capan-2 human PC cell lines were obtained from Sigma-Aldrich (St. Louis, MO, USA) and Thermo Fisher (Waltham ...
-
bioRxiv - Neuroscience 2019Quote: ... the eye cup was treated for ∼ 15 minutes with human plasmin (∼ 50 µg mL−1, Sigma or Haematologic Technologies) to aid vitreous removal.
-
bioRxiv - Biochemistry 2020Quote: ... Other antibodies used in this study include those specific to human CD3 (UCHT1 clone, Cat. number 217570, Merk-Millipore), Vav1 (Cat ...
-
bioRxiv - Microbiology 2019Quote: ... a human telomerase immortalised retinal pigment epithelial line was passaged in Dulbecco’s modified minimal essential medium (DMEM)-F12 (Sigma) supplemented with 200 mM glutamine ...
-
bioRxiv - Immunology 2019Quote: ... monocytes were cultured at 1 × 106 cells/ml in RPMI-1640 medium supplemented with 1% human AB serum (Sigma), 20 ng/ml M-CSF (Peprotech) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human HEK-293T cells were grown in Dulbecco’s Modified Eagle’s high glucose medium with HEPES (Sigma-Aldrich®, D6171) supplemented with 10% fetal bovine serum ...
-
Dual signaling via interferon and DNA damage response elicits entrapment by giant PML nuclear bodiesbioRxiv - Microbiology 2021Quote: ... an additional blocking step was performed by incubating cells with 2 mg/ml γ-globulins from human blood (Sigma) for 30 min at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... Beads were washed with 60x slurry volume in lysis buffer and eluted through overnight incubation at 4°C with 160μl of Human Rhinovirus (HRV)-3C protease (Millipore) in a final volume of 2-3ml ...
-
bioRxiv - Bioengineering 2020Quote: ... Three sections at varying depths within the tumor are immunostained with mouse anti-human nuclei (clone 235-1, Millipore) followed by secondary Dylight 488 horse anti-mouse (Vector) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... IPSCs were plated at 25,000 cells/cm2 in a 24-well plate coated with 15µg/ml human laminin (Sigma, USA). The following day ...
-
bioRxiv - Cell Biology 2021Quote: Cells were seeded onto glass coverslips coated with 5 µg/mL human plasma fibronectin purified protein (EMD Millipore Corporation) at a density of 80,000 cells and 40,000 cells for the PDGFRα homodimer cell line and PDGFRβ homodimer cell line ...
-
bioRxiv - Cancer Biology 2020Quote: Human AGCT-derived KGN cells (Riken, Tsukuba, Japan) and JGCT-derived COV434 cells (Sigma-Aldrich, St. Louis, MO, USA) were cultured in Dulbecco’s modified Eagle’s medium (DMEM)-Ham’s F12 (Caisson ...