Labshake search
Citations for Millipore Sigma :
3201 - 3250 of 10000+ citations for Cyclohexyl 2 3 4 5 trifluorophenyl ethyl ketone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... and the ampicillin media was stained by adding 5 µl and 3 µl of a fluorescent dye (rhodamine, Sigma S1402) in 100ml of media used to grow MG:GT and MG/pBGT cells ...
-
bioRxiv - Cell Biology 2022Quote: ... Samples were then washed (3 × 5 min. in PBS at RT) before staining with DAPI (1:1000; Sigma Aldrich, D9542) and AlexaFluor-488 Phalloidin (1:100 ...
-
bioRxiv - Genomics 2022Quote: ... 75μl of a mix of the 16S probe (5’-GGATTAGATACCCBDGTAGTCGAGATNBAAAAAAAAAAAAAAAAAAAA-3’, IDT, USA) at 0.6μM concentration with 4X Saline Sodium Citrate (SSC) (SSC, Sigma-Aldrich, USA) and 0.1% SDS (Sigma-Aldrich ...
-
bioRxiv - Physiology 2022Quote: Pancreata were injected through the portal vein with 3-5 mL cold Hanks buffer containing 0.95 mg/mL collagenase V (Sigma, USA). The collected pancreata were incubated at 37°C for 7 min ...
-
bioRxiv - Neuroscience 2022Quote: Fly heads from 5 flies (3 samples collected per genotype) were homogenized using a motorized pestle and 50 μL RIPA buffer (Sigma) containing protease and phosphatase inhibitors (cOmplete and PhosStop ...
-
bioRxiv - Neuroscience 2023Quote: ... samples were rinsed 5 × 3 min with double distilled water (ddH2O) and subsequently exposed to 1% aqueous thiocarbohydrazide (TCH) (#88535 Sigma) solution for 20 min ...
-
bioRxiv - Neuroscience 2022Quote: ... and then washed with PB (3 × 5 min; RT) and finally mounted on gelatinised slides and coverslipped with Mowiol DABCO (Sigma). For brightfield microscopy ...
-
bioRxiv - Cancer Biology 2022Quote: ... and a 0.2 nM αV imager strand buffer solution (5-GGAGGA-3’-Atto643, Eurofins) were made using 1× PCA (Sigma-Aldrich), 1× PCD (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2024Quote: ... The flat mount was then rinsed with HBSS and incubated in blocking buffer made with HBSS with 5% bovine serum albumin (Catalog #BP9703-100) (W/V) and 3% Triton X-100 (Sigma) (V/V ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were cultured in 0.4 µm or 3.0 µm pored Transwell inserts and fluorescein isothiocyanate (FITC)-conjugated dextran molecules of 3– 5 kDa or 150 kDa (Sigma) were added at 0.5 mg/ml to the top chamber of the Transwell insert for 24 h ...
-
bioRxiv - Neuroscience 2024Quote: ... homogenized in cytosol lysis buffer (10 mM Hepes, 40 mM KCl, 3 mM MgCl2, 5% glycerol, 0.2% NP40, 1 mM DTT, cOmplete protease inhibitors, Sigma-Aldrich) and incubated for 30 min at 4°C with rotation ...
-
bioRxiv - Plant Biology 2024Quote: ... meliloti 1021 (pXLGD4) strain were stained using 5-bromo-6-chloro-3-indolyl-β-d-galactopyranoside (Magenta-Gal, Sigma-Aldrich), according to the protocol described previously by Jarzyniak et al ...
-
bioRxiv - Developmental Biology 2024Quote: ... All antibody incubations were done in block solution containing 5-10% Normal Donkey serum and 3% Bovine Serum Albumin (BSA, Sigma). After early initial staining ...
-
bioRxiv - Immunology 2024Quote: ... 20 μg cell proteins or 3-5 μg EVs proteins were denatured in LDS sample buffer containing 1M Dithiothreitol (DTT, Sigma) for 10 min at 70°C and loaded onto a 4-12% precast polyacrylamide gels for electrophoresis ...
-
bioRxiv - Cell Biology 2023Quote: ... HeLa cells were transfected with U6-gDNA (5’-AAAGACGTCCCTAACAAGT-3’; clone ID es: HSPD0000063884): CMV-eCas9-2a-tGFP (Sigma-Aldrich). 48h after transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... P1 virus was used to infect 50 ml of SF9 culture and P2 virus was harvested after 3-5 days through centrifugation and subsequent filtration through 0.45 μm PVDF membrane (Merck Millipore, SLHV033RS). P2 virus was either propagated further or stored at 4ºC in the dark ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 mL of each sample was injected onto a ZIC-pHILIC 2.1 3 150 mm (5 mm particle size) column (EMD Millipore). Buffer A was 20 mM ammonium carbonate ...
-
bioRxiv - Neuroscience 2023Quote: ... free-floating sections were first washed in TBS (3 washes for 5 min each) and then treated with 0.25% H2O2 (Cat#216763, Sigma-Aldrich), in TBS for 3 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were subsequently washed 3 × 5 min in 1x TBS/ 0.1% Tween-20 and developed using Immobilon Western HRP Substrate (Millipore, WBKLS0S00) and imaged using the Azure C300 ...
-
bioRxiv - Biochemistry 2023Quote: ... Azo biotin-azide (CAS No. 1339202-33-3) and Imatinib (Cas No.152459-95-5) were obtained from Sigma Aldrich, rapamycin (Cas No.53123-88-9 ...
-
bioRxiv - Biochemistry 2023Quote: ... The slides were washed again carefully with PBS 3 x 5 mins and the coverslips were mounted onto glass microscope slides with Fluoroshield with DAPI (Sigma) and sealed with clear nail varnish ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were washed 3 times for 5 min in PBS and blocked with 3% BSA in PBS-Triton 0.01% (Triton X-100, Sigma, T8787) for 1h ...
-
bioRxiv - Pathology 2023Quote: ... Nuclear fast red solution was prepared using 0.1 g nuclear fast red powder in 100 mL distilled water with 5 g Al2(SO4)3 (Sigma-Aldrich). Deparaffinized slides were washed with distilled water and then incubated with the Alcian blue solution for 30 minutes at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... mice were fasted for four hours before oral gavage of 600 mg/kg FITC–3-5-kDa dextran (Sigma, FD4). Serum was collected six hours after gavage as well as control mice without gavage and analyzed using a Synergy HT plate reader (Bio-Tek ...
-
bioRxiv - Developmental Biology 2023Quote: ... The growth medium of organoids was supplemented with 100μM with 8-Bromoadenosine 3’,5’-cyclic monophosphate sodium salt (8-Br-cAMP) (Sigma, #B7880) in iPSC organoids or 200μM forskolin (FSK ...
-
bioRxiv - Microbiology 2023Quote: ... Protein was then eluted off the agarose by resuspension in 100 µL of 3X FLAG elution buffer (3 µL of 5 mg/mL Sigma 3X FLAG peptide solution + 97 µL of coIP buffer 2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Membranes were again washed 3 × 5 min with PBS + 0.1% Tween 20 and incubated with Classico/Crescendo Western HRP substrate (Millipore-Sigma) for 2 min ...
-
bioRxiv - Microbiology 2023Quote: The synthetic positive control had the sequence: 5’ – TCCTAAAGCACCACGCAGCATCTATCGCGAGCTTAATCACCATGCCGCGTCCAACGCGATCCCCGCTCGGCAGGGATC CCTCTTCTCGCACCGGGCCACAATCCACTGGGGTCGCTATGA – 3’ and was synthesised as an ssDNA oligo (Sigma-Aldrich). The synthesised IS2404 synthetic positive was resuspended in nuclease-free water and diluted to 0.001 pM ...
-
bioRxiv - Developmental Biology 2023Quote: ... for 5 minutes followed by 3 washes in 40mM Tris buffer (pH=7.2) and then 1:20 Giemsa solution (Sigma-Aldrich). The blood and bone marrow were then imaged on a Zeiss Axio Imager.A2 and Zen Blue software (version 3.1).
-
bioRxiv - Cell Biology 2023Quote: ... cells were cultured in 0.4 μm or 3.0 μm pored Transwell inserts and fluorescein isothiocyanate (FITC)-conjugated dextran molecules of 3–5 kDa or 150 kDa (Sigma) were added at 0.5 mg/ml to the top chamber of the Transwell inserts as we previously described41 ...
-
bioRxiv - Cell Biology 2023Quote: ... blots were again washed 3 times (5 min per wash in Tween-20 saline) before addition of ECL (Millipore, MA) for chemiluminescent detection on a BioRad Image Analyzer using Image Lab to capture and quantify signal intensity ...
-
bioRxiv - Cancer Biology 2024Quote: ... each coverslip was washed with PBS 3 times each for 5 minutes and nuclei were stained with Hoechst (Merck Sigma, Burlington ...
-
bioRxiv - Biophysics 2024Quote: ... The PDMS scaffold surface was activated by oxygen plasma and then treated with a 5% (3-aminopropyl) triethoxysilane (Sigma-Aldrich) solution in methanol for 45 min ...
-
bioRxiv - Cell Biology 2024Quote: ... After the last EtOH wash the coverslips were incubated with methanol containing 5% acetic acid and 1% (3-Aminopropyl)triethoxysilane (Millipore-Sigma) overnight in a vacuum desiccation chamber in the dark ...
-
bioRxiv - Neuroscience 2024Quote: ... and the samples were washed 3 times for 5 min in PBS and counter-stained with 1:1000 DAPI (D9542, Sigma) for 15 min ...
-
bioRxiv - Microbiology 2024Quote: ... 10 min) and resuspended in 3-5 ml lysis buffer (150 mM NaCl, 50 mM Tris-HCl, 0.5xCellLytic B [Sigma-Aldrich] ...
-
bioRxiv - Genetics 2024Quote: ... and 3-5 µl plasmid solution (Plasmid concentration 100-200 ng/µl) containing Phenol Red for visualization (0.1% Sigma #P0290) was injected intramuscularly using a Nanofil syringe (WPI ...
-
bioRxiv - Genomics 2024Quote: ... followed by TBST washes (3 x 5 min) and then counterstaining with DAPI (20µg/ml in TBST, D9542, Sigma Aldrich). Slides were then mounted using an antifade reagent composed of 10% v/v Mowiol 4 to 88 ...
-
bioRxiv - Cell Biology 2024Quote: ... the coverslips were washed 3 times for 5 min with PBST and mounted on microscope slides using Mowiol (EMD Millipore) as the mounting agent ...
-
bioRxiv - Cell Biology 2024Quote: ... Moreover, a non-targeting control siRNA (NT siRNA, or siCON) with the sequence 5’-CGUACUGCUUGCGAUACGGUU-3’ was used (Sigma-Aldrich). Cells were transfected with 22 pmol of siRNA oligonucleotides/well using Lipofectamine RNAiMAX (ThermoFisher Scientifc ...
-
bioRxiv - Bioengineering 2024Quote: ... silicone plates were plasma treated for 5 minutes followed by incubation with 10% (3-aminopropyl)triethoxysilane (APTES; #440140; Sigma-Aldrich) in ethanol at 60°C for 60 minutes ...
-
bioRxiv - Biophysics 2024Quote: ... labelled BGZP-C were prepared in 25 mM 2H-glycine buffer at pH 11.0 or 25 mM phosphate buffer at pH 6.0 in either straight 3 mm tubes (Wilmad, Vineland, NJ) or 5 mm susceptibility-matched microcells (Shigemi, Sigma-Aldrich). Separate samples ...
-
bioRxiv - Biophysics 2024Quote: ... The reaction was stirred under N2 for 5 minutes before 0.71 mg (1.05 eq) of 3-morpholinopropylamine (Sigma-Aldrich Inc) was added ...
-
bioRxiv - Microbiology 2024Quote: ... and their lungs were minced with scissors and digested in 3 ml of RPMI-1640 with 5% heat-inactivated FBS containing 1 mg/ml collagenase D (Sigma) and 30 µg/ml DNAseI (Sigma ...
-
bioRxiv - Microbiology 2024Quote: ... mice were intranasally administered with 3 µg of the RSP protein and 5 μg of cholera toxin (CT; Sigma-Aldrich) as immunological adjuvant ...
-
bioRxiv - Bioengineering 2024Quote: ... or 3-5×105 pelleted cells were lysed in TRI Reagent (“LS” for fluid EV samples, conventional for cells, Merck Millipore). Liquid chloroform was added to the lysates at a 1:5 v/v ratio and vigorously mixed for 30 s ...
-
bioRxiv - Bioengineering 2024Quote: ... 5 µL of cell suspension was mixed with 5 µL of fibrinogen solution (6 mg/mL, final concentration 3 mg/mL, 8630, Sigma) by pipetting up and down three times ...
-
bioRxiv - Biochemistry 2024Quote: RNA oligonucleotides derived from MALAT1 (5’-AACUU AAUGU UUUUG CAUUG GACUU UGAGUU -3’) were synthesized with or without m6A modification (Sigma). Oligonucleotides and the indicated pri-miRs were radiolabeled at 5’ ends with γ32P-ATP using T4 polynucleotide kinase ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Extracts were then clarified at 4’000 × g for 10 min and concentrated to ~4 mg/mL total protein concentration using 3 kDa molecular weight cutoff (MWCO) Centriprep concentrators (EMD Millipore) to account for dilution during preparation ...
-
bioRxiv - Cell Biology 2020Quote: NHP heart slices seeded with HVPs/CMs after RFA injury were loaded with 3 μM Fluo-4-AM in CCM (without phenol red) supplemented with 0.75% Kolliphor EL (Sigma Aldrich, USA) by incubation at 37°C for 60 minutes ...