Labshake search
Citations for Millipore Sigma :
251 - 300 of 2658 citations for ssc mir 376c RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... and TruSeq primers (Sigma). Libraries were gel purified (Qiagen ...
-
bioRxiv - Cancer Biology 2019Quote: ... using primers (Sigma-Aldrich) and amplification program described by McEvoy et al ...
-
bioRxiv - Cell Biology 2021Quote: ... We designed primers (Sigma) as follows ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lyophilised primers (Sigma Aldrich) were designed using exon spanning sequences in primer3 ...
-
bioRxiv - Neuroscience 2021Quote: ... oligonucleotide primers (Sigma Aldrich) specific to target genes and SYBR Green (KAPA Syber1 FAST PCR Master Mix (2X ...
-
bioRxiv - Immunology 2021Quote: ... NLRP3 primer pair (Sigma): forward 5’ -TCAGCACTAATCAGAATCTCACGCACCTTT -3’ and reverse 5’ -CCAGGTCATTGTTGCCCAGGCTC -3’ ...
-
bioRxiv - Microbiology 2021Quote: ... The primers (Sigma-Aldrich) used are listed below ...
-
bioRxiv - Microbiology 2021Quote: ... The primers (Sigma-Aldrich) used are listed below ...
-
bioRxiv - Immunology 2020Quote: ... The primers (Sigma–Aldrich) used are listed in Table 1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... with primers (Sigma-Aldrich) containing condition specific ...
-
bioRxiv - Immunology 2022Quote: ... DRAM1 primers (Sigma-Aldrich) used are as follows ...
-
bioRxiv - Genomics 2022Quote: ... Sequences of primers (Sigma) used are ...
-
bioRxiv - Microbiology 2022Quote: ... Primer pairs (Sigma Aldrich) are listed in the table below ...
-
bioRxiv - Neuroscience 2022Quote: ... Primer probes (Sigma-Aldrich) were designed to span exon boundaries ensuring amplification of only mRNA (see Table S1) ...
-
bioRxiv - Neuroscience 2023Quote: ... and oligonucleotide primers (Sigma). The DNA sequence of the entire coding region was then verified by Genewiz/Azenta to obtain point mutations T214F ...
-
bioRxiv - Neuroscience 2023Quote: ... Primers pairs (Sigma-Aldrich) specific for Il6 ...
-
bioRxiv - Neuroscience 2023Quote: ... Oligonucleotide primers (desalted; Sigma) for genotyping targeted alleles and transgenes by PCR are described in Supplementary Table 2.
-
bioRxiv - Physiology 2024Quote: ... and predesigned primers (Sigma KiQStart Primers ...
-
bioRxiv - Cancer Biology 2022Quote: ... and phosphatase inhibitors (Phosphatase Inhibitor Cocktail Set I #524624 and Phosphatase Inhibitor Cocktail Set II #524625; Millipore Sigma-Aldrich), was added directly on the plated cells and lysed for 15 min on ice ...
-
bioRxiv - Systems Biology 2024Quote: ... the negative control set as 0.1% DMSO and the positive control set as 100 µM etoposide (Sigma Aldrich, Germany), and a media blank column (plated per column) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The cells were then transfected with 50 nmol/L miR-6883 mimic (Sigma-Aldrich (HMI2616) using Lipofectamine® RNAiMAX Reagent ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNAs were PCR-amplified using specific primers (Table 1) and a JumpStart REDTaq ReadyMix Reaction Mix (Sigma-Aldrich, MO, USA). α-tubulin and water (“no DNA” ...
-
bioRxiv - Microbiology 2020Quote: ... The construction of baculovirus transfer vectors encoding hVP3 mutant polypeptides were generated using PCR-based site directed mutagenesis on the pFB/hisVP3 plasmid (Kochan et al. 2003) using synthetic DNA oligonucleotide primers (Sigma) described in Supplementary Table 1 ...
-
bioRxiv - Genomics 2022Quote: ... Conserved regions were amplified from genomic leaf DNA in a standard polymerase chain reaction (PCR) using specific primers synthesized commercially (Sigma). PCR products were labeled with biotin-16-dUTP or digoxigenin-11-dUTP using BioPrime CGH array labelling kit (Invitrogen) ...
-
bioRxiv - Immunology 2021Quote: ... genomic DNA was extracted from ear clips and amplified by polymerase chain reaction (PCR) using the relevant forward (FP: 5’AAACTGGGCTCTCCGCTGCTG3’) and reverse (RP:5’AGTAGAGTATCGTGCATGGTCCTGG3’) primers (Taq polymerase (Sigma) at an annealing temperature (Tm ...
-
bioRxiv - Biochemistry 2020Quote: ... encoding the cpeB gene from Prochlorococcus marinus MED4 was PCR amplified with primers (Table 4) encompassing selected recognition sites (EcoRI, HindIII) for cloning into pCOLADuet (Novagen).
-
bioRxiv - Molecular Biology 2022Quote: ... 0.5 μg of genomic DNA were used for PCR reaction with primer 495 and 489 (Supplemental Table 1) with Red taq (Sigma) with the following PCR condition ...
-
bioRxiv - Molecular Biology 2024Quote: cDNAs of BTB domains were PCR-amplified using corresponding primers (Supplementary Table S1) and cloned into modified pET32a(+) vector (Novagen) encoding TEV protease cleavage site after 6xHis-tag and Thioredoxin ...
-
bioRxiv - Microbiology 2023Quote: ... gene was PCR amplified from individual spores with primers AML225 (GAACCCAAACACTTTGGTTTCC) and WANDA26 (CAGCCGCGGTAATTCCAGCT) using JumpStart RedTaq DNA Polymerase Master Mix (Sigma). PCR products were sent for cleaning and Sanger sequencing (Macrogen Europe) ...
-
bioRxiv - Microbiology 2023Quote: ... were obtained by PCR with the primers P1-P2 and P2-P4 respectively (Supplementary Table 2) and cloned into pETDuet-1 (Novagen) using the In-Fusion HD Cloning system (Clontech) ...
-
bioRxiv - Neuroscience 2023Quote: A 3 bp mutation was introduced into the CMV:dreammist-GFPpA by inverse PCR using specific primers (Table 2) and KOD high fidelity hot start polymerase (Millipore 71085). The template was degraded by DpnI digest and circular PCR product was transformed into OneShot TOP10 chemically competent E coli (Invitrogen C4040) ...
-
bioRxiv - Biophysics 2022Quote: ... into the WT-CaM construct in the pET21a vector using standard PCR mutagenesis after residue D80 of the protein sequence using primers ordered from Sigma-Aldridge (Merck) ...
-
bioRxiv - Biochemistry 2024Quote: A DNA consisting of 2 base pairs-Widom 601 sequence (145 base pairs)-2 base pairs was amplified by PCR using a 5’-/6-FAM forward primer (Sigma). The PCR products were pooled from four 96-well PCR plates (100 µL per well ...
-
bioRxiv - Molecular Biology 2020Quote: ... Not hybridized padlock probes were removed by washes with 10% Formamide in 2X SSC (Sigma-Aldrich, S6639). To minimize the effect of the previously documented SplintR ligase nucleotide preferences (26 ...
-
bioRxiv - Cell Biology 2020Quote: ... fixed cells were washed with PBS and hybridization buffer (15% formamide from Sigma-Aldrich in 1X SSC), and then incubated overnight at 37°C in the hybridization buffer also containing 130 ng of the probe set for 100 μl of final volume ...
-
bioRxiv - Cell Biology 2022Quote: ... The ovaries were then washed twice in HYBEC wash solution (2x SSC, 15% ethylene carbonate (Sigma Aldrich), 1mM EDTA ...
-
bioRxiv - Neuroscience 2022Quote: ... The tissue was rinsed three times with 1X DEPC PBS and washed in 0.2X SSCT [0.2X SSC (Quality Biological) and 0.1% Triton X-100 (Sigma) in DEPC water (1:1000 DEPC in ultrapure water ...
-
bioRxiv - Molecular Biology 2019Quote: ... at 1200J/m and subsequently blocked in hybridisation buffer (5X SSC, 5% Dextran sulphate (Sigma-Aldrich, D8906) 0.2% Tropix I-Block (Applied Biosystems ...
-
bioRxiv - Immunology 2020Quote: ... Dead cells and doublets were excluded on the basis of FSC and SSC distribution and DAPI (Sigma) exclusion ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were rehydrated in RNAse-free 1x SSC buffer containing 15% (v/v) formamide (Sigma-Aldrich®) for 15 minutes and then hybridization solution was applied to coverslips overnight ...
-
Ultra-high-throughput microbial single-cell whole genome sequencing for genome-resolved metagenomicsbioRxiv - Microbiology 2022Quote: ... the barcode beads were washed three times in 6 x SSC buffer (Sigma, catalog no. S0902-1L) and loaded into Countess (Thermo-Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... tissue slides were washed twice in Stringent Wash Buffer (2× saline-sodium citrate (SSC) (Millipore Sigma, S6639) in 50% formamide (Millipore Sigma ...
-
bioRxiv - Cancer Biology 2024Quote: ... Slides were then incubated with 0.5 µg/ml Hoechst 33258 in 2x saline sodium citrate (SSC) (Sigma) for 15 min and exposed to UV for 30 min in 2x SSC before being treated with exonuclease III (3 U/µl ...
-
bioRxiv - Biochemistry 2023Quote: ... 000 total cell events were gated with FSC/SSC gate on a Guava Easycyte 10HT instrument (Millipore). A second gate for high mCherry transfection efficiency was applied ...
-
bioRxiv - Developmental Biology 2023Quote: ... Samples were washed with 2×20 min SSC-T and incubated in 20 μM Hoechst (Sigma, 2261) diluted in 1×PBS at room temperature in dark for 30 min ...
-
bioRxiv - Cell Biology 2023Quote: ... Neurons were then incubated in pre-hybridization buffer [1X SSC solution containing 5% Dextran sulfate (Sigma, D8906), 10mg/ml ultrapure BSA ...
-
bioRxiv - Microbiology 2021Quote: ... Primers were designed in Primer-BLAST51 and synthesized by Sigma-Aldrich (MO, USA). The designed primer pairs were specificity checked and optimised ...
-
bioRxiv - Microbiology 2019Quote: ... Triplicate reactions were started at RT in PCR tubes by addition of an NAD+-mixture resulting to final concentrations of 24.5 µM NAD+ (Sigma, N3014) and 0.5 µM of biotinylated NAD+ (Trevigen ...
-
bioRxiv - Molecular Biology 2023Quote: 10% of the RT reaction was used as the template in 25 μl PCR reactions containing 1.25U of JumpStart Taq Polymerase (Sigma D9307), 1×PCR buffer (Sigma P2192) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and a random RT-PCR amplification was performed using the TransPlex® Complete Whole Transcriptom Amplification Kit WTA2 (Merck Millipore) following the manufacturers’ instructions ...