Labshake search
Citations for Millipore Sigma :
301 - 350 of 2658 citations for ssc mir 376c RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... and a random RT-PCR amplification was performed using the TransPlex® Complete Whole Transcriptom Amplification Kit WTA2 (Merck Millipore) following the manufacturers’ instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... The mRNA expression levels of PIWIL1 and Actin were examined by semiquantitative RT-PCR from total RNA using TriZol Reagent (Sigma) 72 h after siRNA transfection.
-
bioRxiv - Molecular Biology 2023Quote: ... or MMLV-RT (Sigma), following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... protease inhibitor (Protease Inhibitor Cocktail Set III, Sigma)) and sonicated for 2 minutes (15s on ...
-
bioRxiv - Biochemistry 2020Quote: ... protease inhibitor (Protease Inhibitor Cocktail Set III, Sigma)) and sonicated for 2 minutes (15s on ...
-
bioRxiv - Neuroscience 2020Quote: ... and phosphatase inhibitor cocktail set III (Millipore-Sigma). Insoluble material was removed by centrifugation at 14,000g for 20 min at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... and phosphatase inhibitor cocktail set III (Millipore-Sigma). Insoluble material was removed by centrifugation at 14,000g for 20 min at 4°C ...
-
bioRxiv - Immunology 2020Quote: ... and Protease Inhibitor Cocktail Set V (EMD Millipore) were purchased from the indicated sources ...
-
bioRxiv - Molecular Biology 2019Quote: ... supplemented with 2x protease inhibitor cocktail set (Millipore)) ...
-
bioRxiv - Biochemistry 2021Quote: ... protease inhibitor (Protease Inhibitor Cocktail Set III, Sigma)) and sonicated for 2 minutes (15s on ...
-
bioRxiv - Biochemistry 2021Quote: ... protease inhibitor (Protease Inhibitor Cocktail Set III, Sigma)) and sonicated for 2 minutes (15s on ...
-
Synthetic lethal targeting of TET2-mutant hematopoietic stem and progenitor cells by XPO1 inhibitorsbioRxiv - Cancer Biology 2022Quote: ... and Phosphatase Inhibitor Cocktail Set II (EMD Millipore). Immunoblotting was performed with each of the specific antibodies to TET2 (CST ...
-
bioRxiv - Biochemistry 2022Quote: ... protease inhibitor (Protease Inhibitor Cocktail Set III, Sigma)) and sonicated for 2 minutes (15s on ...
-
bioRxiv - Biochemistry 2022Quote: ... protease inhibitor (Protease Inhibitor Cocktail Set III, Sigma)) and sonicated for 2 minutes (15s on ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1X protease inhibitor cocktail set I (Sigma, #539131). Extracts were clarified by centrifugation ...
-
bioRxiv - Developmental Biology 2024Quote: ... and Phosphatase Inhibitor Cocktail Set II (Millipore #524625) for 30 minutes at 4°C ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with protease inhibitor set I (Sigma, 539131) and phosphatase inhibitor set II (Sigma ...
-
bioRxiv - Biochemistry 2023Quote: ... protease inhibitor (Protease Inhibitor Cocktail Set III, Sigma)) and sonicated for 2 minutes (15s on ...
-
bioRxiv - Biochemistry 2023Quote: ... protease inhibitor (Protease Inhibitor Cocktail Set III, Sigma)) and sonicated for 2 minutes (15s on ...
-
bioRxiv - Cancer Biology 2020Quote: ... Genomic regions containing guide sequences are PCR amplified using paired primers with 25 uL 2x JumpStart Taq Polymerase Ready Mix (Sigma-Aldrich), 1.5 uL 10 uM primer pair (CropSeq_NGS_P7 ...
-
bioRxiv - Microbiology 2022Quote: ... a first PCR was performed using the templates and primers shown in Table 1 with KOD hot start DNA polymerase (Sigma-Aldrich), with annealing time of 30 seconds at the indicated temperature ...
-
bioRxiv - Plant Biology 2022Quote: Conserved regions were amplified in a standard Polymerase Chain Reaction (PCR) using genome-specific primers (Linares et al., 1998; Liu et al., 2019) synthesized commercially (Sigma-Aldrich). These probes were labelled with digoxigenin-11-dUTP ...
-
bioRxiv - Biochemistry 2024Quote: ... R-domain phosphorylation sites and interacting residues mutants were generated by site-directed mutagenesis using a Q5-New England Biolabs PCR mutagenesis kit together with primers synthesized from Millipore sigma and verified by sequencing (Elim Biopharmaceuticals ...
-
bioRxiv - Genetics 2023Quote: ... Our method of genotyping involved PCR amplification across mutation sites using the primers described in Table 1 (purchased from Sigma Aldrich). Then ...
-
bioRxiv - Microbiology 2023Quote: ... The cassette corresponding the DHFR-pSAG1-TgAPT1-GFP cassette was amplified by PCR from the plasmid of the same name using primers ML3088/ML3089 with the KOD DNA polymerase (Sigma-Aldrich). This donor sequence was then used to transfected to Pru background ...
-
bioRxiv - Neuroscience 2020Quote: ... Ant-miR-218 or Ant-scrambled was dissolved in sterile PBS (Sigma-Aldrich, Oakville, ON, Canada) at a final concentration of 0.3nM and infused with a total volume of 0.5μl of Ant-miR-218 or Ant-scrambled over a 7-min period as in(31 ...
-
bioRxiv - Neuroscience 2019Quote: ... Ant-miR-218 or Ant-scrambled were dissolved in sterile PBS (Sigma-Aldrich, Oakville, ON, Canada) at a final concentration of 0.3 mM ...
-
bioRxiv - Cell Biology 2024Quote: ... the NCBI Primer designing tool was used to design primers that were custom-synthesized by Sigma-Aldrich (primer sequences listed in Table 1) and cDNA sample amplification was performed with the KAPA SYBR FAST qPCR Kit (KapaBiosystems ...
-
bioRxiv - Developmental Biology 2021Quote: ... 10 mMTris-HCl in 2x SSC) supplemented with 1 μl of 3.7 mg/ml glucose oxidase (Sigma-Aldrich) and 1 μl of 5 mg/ml Catalase (Sigma-Aldrich) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Coverslips were incubated for pre-hybridization in wash buffer (2x saline-sodium citrate (SSC) with deionized formamide (Sigma) 10% ...
-
bioRxiv - Developmental Biology 2020Quote: ... Embryos were incubated in hybridization buffer (50% Formamide, 4x SSC pH 4.5, 1% SDS, 50μg/ml heparin (Sigma), 10μg/ml tRNA from baker’s yeast (Sigma) ...
-
bioRxiv - Genomics 2021Quote: ... Coverslips were incubated for pre-hybridization in wash buffer (2x saline-sodium citrate (SSC) with deionized formamide (Sigma) 10% ...
-
bioRxiv - Genomics 2019Quote: ... The supernatant was discarded and the pellet was resuspended in a small volume of SSC cocktail (3xSSC [Sigma; S0902] ...
-
bioRxiv - Cell Biology 2022Quote: ... dishes were washed with wash buffer (1x saline-sodium citrate, SSC, Sigma-Aldrich, in 10% deionized formamide, Ambion) for 5 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... the slides were washed with the RNAscope wash buffer and incubated with 5X SSC (Sigma-Aldrich, S6639-1L) overnight at RT ...
-
bioRxiv - Molecular Biology 2024Quote: ... slides were washed with stringent buffer (1:1, formamide:4X SSC buffer; Thermo Fisher #AM9342; Sigma-Aldrich #S6639) at 37°C twice for 25 minutes each ...
-
bioRxiv - Developmental Biology 2023Quote: ... SSCs were seeded on STO feeders which were prepared 1 day before on Millicell EZ SLIDE (PEZGS0816, Millipore). SSCs were treated with 4-OHT at 0.1µM or RA at 1 µM or vehicle for the indicated time ...
-
bioRxiv - Immunology 2023Quote: ... Samples were then washed three times with 1X PBS and stored overnight in 5X SSC buffer (Millipore Sigma). Next ...
-
bioRxiv - Plant Biology 2019Quote: ... The allele-specific forward primers and common reverse primers were synthesised by Sigma-Aldrich. Allele-specific primers were synthesised with standard FAM or VIC compatible tails at their 5’ ends (FAM tail ...
-
bioRxiv - Microbiology 2021Quote: ... Top2β: Forward primer 5’CAGCCCGAAAGACCTAAATAC and reverse primer 5’ATCTAACCCATCTGAAGGAAC obtained from Sigma-Aldrich.
-
bioRxiv - Developmental Biology 2024Quote: ... Primers were designed using Primer-BLAST (National Institutes of Health) and obtained from Sigma. For each primer pair ...
-
bioRxiv - Plant Biology 2023Quote: ... 8 pmol M13-labeled forward primer and 32 pmol reverse primer (Sigma Life Science), standard Taq buffer (New England Biolabs) ...
-
bioRxiv - Microbiology 2021Quote: ... and oligonucleotide primers (Sigma-Aldrich) used for experimental work in this study are listed in Table 1 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Primers were synthesized by Sigma and IDT.
-
bioRxiv - Neuroscience 2019Quote: ... The following primers (Sigma-Aldrich), mapping outside the ssODN sequence were used to amplify a region of ≈ 700 bps containing the edited region of the Pde6b gene ...
-
bioRxiv - Microbiology 2019Quote: ... Primers were purchased from Sigma and their sequences listed in Table 3 ...
-
bioRxiv - Neuroscience 2020Quote: ... Primers used (Sigma, Dublin, Ireland) are listed in Table S4.
-
bioRxiv - Neuroscience 2021Quote: ... The DNA primers (Sigma-Aldrich) used for genotyping are listed in Table S7.
-
bioRxiv - Bioengineering 2020Quote: ... Custom designed primers (Sigma-Aldrich) with the sequences presented in Table 1 were used as myogenic and immunogenic markers ...
-
bioRxiv - Neuroscience 2020Quote: ... Primers were ordered from Sigma as lyophilized and reconstituted in Milli-Q water to a stock concentration of 100 μM and further diluted to a 10 μM working stock ...