Labshake search
Citations for Millipore Sigma :
151 - 200 of 2658 citations for ssc mir 376c RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... using PCR primers Ad1_noMX and Ad2_Barcode (Sigma-Aldrich, see Table 2, (Buenrostro et al., 2013) for 5 initial cycles (1 cycle ...
-
bioRxiv - Immunology 2022Quote: ... cDNAs were mixed with indicated gene-specific primers and SYBR green PCR Master Mix (Sigma), and qRT-PCR was performed on an Applied Biosystems 7900HT Fast Real-Time PCR system.
-
bioRxiv - Physiology 2023Quote: ... and included predesigned primers (Sigma KiQStart Primers). Gene expression was normalized using housekeeping genes β-ACTIN ...
-
bioRxiv - Microbiology 2024Quote: ... 0.4 µl 10 µM reverse tailed specific primer and 12.72 µl PCR grade water (contained in the Kap2G Robust PCR kit Sigma Catalogue No. KK5005) per sample and 18 µl added to each well to be used in a 96-well plate followed by 2 µl of DNA and mixed ...
-
bioRxiv - Cancer Biology 2020Quote: ... Phosphatase inhibitor cocktail set II and protease inhibitor cocktail set III (EMD Millipore) were added at the time of lysis ...
-
bioRxiv - Cancer Biology 2022Quote: ... The slides were then incubated with SSC buffer (Sigma-Aldrich/MLS, # S6639-1L) overnight at room temperature ...
-
bioRxiv - Cell Biology 2019Quote: ... DNA was counterstained with DAPI (0.1 μg/mL in 2× SSC; Sigma-Aldrich), and ...
-
bioRxiv - Neuroscience 2024Quote: ... The sections were stored in 5X SSC buffer (Sigma-Aldrich, cat. no. S6636) overnight at RT ...
-
bioRxiv - Cell Biology 2024Quote: ... which consists of SSC wash buffer + 10% [w/v] dextran sulfate (Sigma D8906) + 2 mM vanadyl-ribonucleoside complex (NEB S1402 ...
-
bioRxiv - Genetics 2023Quote: ... chromosomes were denatured in 75% formamide in 2× SSC (pH 7.0) (Sigma-Aldrich) at 72 °C for 3 min ...
-
bioRxiv - Biophysics 2022Quote: ... sub-cloned into the pNKS2 vector) via PCR with custom-designed primers (Eurofins Genomics, Sigma-Aldrich) and PfuUltra II Fusion HS DNA polymerase (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: TRPM8 sequences were amplified by PCR using the following primers (ordered from Millipore Sigma, Burlington, MA):
-
bioRxiv - Developmental Biology 2020Quote: ... Primers (Sigma) were designed with PrimeTime (https://eu.idtdna.com/scitools/Applications/RealTimePCR/) ...
-
bioRxiv - Microbiology 2019Quote: ... Primers (Sigma) used are shown in Extended Table 2 ...
-
bioRxiv - Immunology 2021Quote: ... Primers (Sigma) used were as follows:
-
bioRxiv - Cancer Biology 2021Quote: ... Primers (Sigma) are listed in Supplementary Table No ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Primers (Sigma) included type IIS restriction sites for later cloning ...
-
bioRxiv - Neuroscience 2022Quote: ... Primers (Sigma) were designed on different exons to avoid the amplification of genomic DNA (Table 1) ...
-
bioRxiv - Cell Biology 2021Quote: ... RT-qPCR analysis was performed using the KAPA SYBR Fast PCR master mix (Sigma Aldrich, #KK4605) or SYBR Green PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Microbiology 2020Quote: ... RT-PCR on both gDNA and cDNA was performed using the SYBR® Green JumpStart (Sigma) in a 7500 Fast Real Time PCR cycler from Applied Biosystems.
-
bioRxiv - Cancer Biology 2023Quote: ... Hsa-miR-203 mimics were purchased from Sigma Aldrich (MISSION microRNA mimics) and transient transfection was performed using Lipofectamine 2000 (Sigma) ...
-
bioRxiv - Genomics 2021Quote: ... The HybriSlips were removed by dipping the slides in 2x SSC (Sigma Aldrich, S6639)/0.1% Tween20 ...
-
bioRxiv - Genomics 2024Quote: ... cells were incubated with hybridization buffer (15% formamide from Sigma-Aldrich in 1× SSC) for 15 min ...
-
bioRxiv - Biophysics 2023Quote: ... After a washing with 2x Saline-Sodium Citrate buffer (SSC, Sigma-Aldrich, cat. S6639), coverslips were incubated overnight at RT in a solution of 50% formamide (pH 7.0 ...
-
bioRxiv - Genetics 2023Quote: ... chromosome denaturation was done in 75% formamide in 2× SSC (pH 7.0) (Sigma-Aldrich) at 72 °C ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by 3 min at 60 in 0.4× SSC/0.3 % IGEPAL (Sigma-Aldrich Inc.) and further 3 min in 2× SSC/0.1 % IGEPAL at RT ...
-
bioRxiv - Immunology 2023Quote: ... with predesigned primers (Sigma-Aldrich, KiCqStart SYBR Green Primers) specific for murine Il10 ...
-
bioRxiv - Genetics 2021Quote: ... qRT-PCR was performed using gene-specific primers (Table S3) with Kapa SyBr Fast (Sigma-Aldrich, #KK4618) in an Applied Biosystem ViiA 7 real-time PCR system.
-
bioRxiv - Bioengineering 2019Quote: ... PCR was performed using control primers beyond the homology regions with KODXtreme Taq polymerase (Millipore, Massachusetts, USA). Where indicated ...
-
bioRxiv - Developmental Biology 2023Quote: ... qRT-PCR was performed on Bio-Rad CFX96 real time (qPCR) system using predesigned KiCqstart primers (Sigma) and TBB green (#RR-208A ...
-
bioRxiv - Neuroscience 2021Quote: Genomic DNA was extracted from tail tissues and amplified with specific PCR primers using REDExtract-N-Amp™ Tissue PCR kit (Cat. No. XNAT-100RXN, Sigma-Aldrich, Saint Louis, MO) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: We performed reverse transcription using the First strand cDNA synthesis kit for RT-PCR (AMV) (Sigma-Aldrich) and the protocol described by the supplier ...
-
bioRxiv - Microbiology 2020Quote: ... presence of enzyme inhibitors in RNA extracts was assessed by reverse transcription PCR (eAMV RT, Sigma-Aldrich) using universal primers for 18S RNA ...
-
bioRxiv - Microbiology 2020Quote: For real-time quantitative reverse transcription PCR (RT-qPCR) total cellular RNA was extracted with Trizol (Sigma) or QiAmp (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: Quantitative real-time PCR (rt-qPCR) was carried out using the KAPA SYBR® FAST Mix (Sigma) on a LightCycler 480 (Roche Diagnostics ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1% protease inhibitor cocktail set III and 1% phosphatase inhibitor cocktail set IV (EMD Millipore Corporation). Cells were scraped ...
-
bioRxiv - Cancer Biology 2019Quote: ... The transfecting miR-590-5p mimics and inhibitors were obtained from Sigma-Aldrich, and the negative control (NC ...
-
bioRxiv - Immunology 2021Quote: ... Specific primers were purchased from Sigma (KiCqStart SYBR Green Primers) for the detection of the different genes ...
-
bioRxiv - Molecular Biology 2019Quote: ... Set III Protease Inhibitor Cocktail (Millipore) 1:100 ...
-
bioRxiv - Microbiology 2024Quote: ... qRT-PCR reaction mixtures were set up with 10 µl of SYBR® Green JumpStart™ Taq ReadyMix™ (Sigma-Aldrich), 2 µl primers (final concentration 1 µM) ...
-
bioRxiv - Molecular Biology 2021Quote: AC16 human cardiomyocytes were purchased from EMD Millipore (SSC #109) and cultured in Dulbecco’s modified Eagle’s medium: Nutrient mixture F-12 (Sigma #D6434) supplemented with 2mM L-glutamine ...
-
bioRxiv - Neuroscience 2020Quote: ... and then prehybridized (50% formamide [ThermoScientific 15515026], 5X SSC [ThermoScientific AM9763], 1X denhardt’s solution [Sigma D2532] ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Denaturation of chromosomes was done in 75% formamide in 2× SSC (pH 7.0) (Sigma-Aldrich) at 72 °C ...
-
bioRxiv - Plant Biology 2023Quote: ... This was followed with a wash with 0.1 × SSC buffer (Sigma-Aldrich, cat no. S6639L). The sections were permeabilized with Permeabilization mix™ (10x Genomics ...
-
bioRxiv - Biophysics 2020Quote: ... Single- and double-mutant constructs of hERG were produced using conventional overlap PCR with primers synthesized by Sigma Genosys (Oakville ...
-
bioRxiv - Microbiology 2022Quote: ... tuberculosis H37Rv genomic DNA by polymerase chain reaction (PCR) using primers that were synthesized by Sigma (Table S3). Hybrid combinations of genes or introduction of affinity tags were achieved with the use of nested primers ...
-
bioRxiv - Neuroscience 2022Quote: ... Quantitative PCR was performed for the amplification of cDNAs using the appropriate primers (Sigma-Aldrich, see Table S2) and the GoTaq® qPCR Master Mix (Promega) ...
-
bioRxiv - Neuroscience 2020Quote: qPCR (q-PCR) primers were designed using Universal probe library Assay Design Center and were purchased from Sigma. Transcriptor High Fidelity cDNA Synthesis Kit (Roche ...
-
bioRxiv - Immunology 2021Quote: ... qRT-PCR analysis was performed with PerfeCTa SYBR Green Fastmix (Quantabio) using the following primers from Sigma-Aldrich: S1pr1 (5’-AGCTTTTCCTTGGCTGGAGAG ...
-
bioRxiv - Cancer Biology 2022Quote: The integrated gRNAs were sequenced by the following primers using the Expand High Fidelity PCR system (Sigma-Aldrich): GeCKO 1717F 5′-GAGGGCCTATTTCCCATGAT-3′ and GeCKO 3913R 5′- CGGTGCCACTTTTTCAAGTT -3′ ...