Labshake search
Citations for Millipore Sigma :
251 - 300 of 10000+ citations for 6H Imidazo 4 5 1 de acridin 6 one 5 3 diethylamino propyl amino 8 hydroxy since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 100 µM 2’(3’)-O-(4-Benzoylbenzoyl) adenosine 5’-triphosphate (BzATP) (#B6396, Sigma-Aldrich), 20 µM MCC950 (#inh-mcc ...
-
bioRxiv - Genomics 2023Quote: ... we treated 3 x 105 cells with 5 μM 4-hydroxytamoxifen (Sigma Aldrich #T176) for 24 h ...
-
Metabolomics reveals nucleoside analogs for regulating mucosal-associated invariant T cell responsesbioRxiv - Immunology 2023Quote: ... and substrates 5-bromo-4-chloro-3’-indolyphosphate/nitro-blue tetrazolium (BCIP/NBT, Sigma). We used CTL-ImmunoSpot S6 Micro Analyzer to visualize and quantify IFNγ+ MAIT cell spots ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 5-bromo-4-chloro-3’-indolyphosphate p-toluidine salt (BCIP, Sigma Israel, B8503). In the Snai2/RSPO1 ISH experiment ...
-
bioRxiv - Neuroscience 2023Quote: ... 8 mM NaCl (Sigma-Aldrich, 7647-14-5), 10 mM HEPES ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5-8 μg/ml of polybrene (Sigma Aldrich) was supplemented in the media ...
-
bioRxiv - Neuroscience 2020Quote: ... 2-(5-Benzo [1,3] dioxol-5-yl-2-tert-butyl-3HImidazol-4-yl)-6-methylpyridine hydrochloride hydrate (SB505124) (Sigma-Aldrich; St. Louis, MO) and implanted subdermally ...
-
bioRxiv - Bioengineering 2021Quote: ... The secondary antibodies were washed away with PBS (3x 5 min) whereafter 4’,6-diamidino-2-phenylindole (DAPI, 1:500, Sigma) was added for 10 minutes to localize the cell nuclei ...
-
bioRxiv - Neuroscience 2021Quote: ... nuclear labelling was achieved by incubating the sections for 5 min in DAPI (4′,6-diamidino-2-phenylindole; 1:5000; Sigma). Two final washes in PBS were performed before the sections were mounted on glass slides using Vectashield (Vector Laboratories ...
-
bioRxiv - Molecular Biology 2019Quote: ... cells were washed three times in PBS and mounted in 70% glycerol with with 5 μgml-1 concentration of 4-6-diamidino-2-phenylindole (DAPI, Sigma) and cells were mounted on cover slips ...
-
bioRxiv - Immunology 2024Quote: ... slides were washed in PBS and incubated in 5 μg mL-1 4’,6-diamidino-2-phenylindole (DAPI) (Sigma Aldrich) in PBS (Sigma Aldrich ...
-
bioRxiv - Genetics 2021Quote: ... Mouse neural progenitor cells were routinely passaged 1:2-1:4 every 3-5 days using Accutase and maintained in NS expansion medium on laminin-coated plates (Sigma, 3 μg/ml). Both mESCs and mNPCs were incubated at 37 °C and 5% CO2 ...
-
bioRxiv - Microbiology 2020Quote: ... 5,6,7,8-tetradeutero-4-hydroxy-2- heptylquinoline (HHQ-d4, Sigma) was used as an internal standard ...
-
bioRxiv - Cancer Biology 2019Quote: ... MEFs were treated with 4-hydroxy-tamoxifen (4-OHT; 1μM, Sigma H6278). Mice were injected intraperitoneally with Tamoxifen (1 mg dissolved in corn oil ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were treated with 1uM 4-hydroxy-Tamoxifen (4-OHT, Sigma-Alderich)
-
bioRxiv - Plant Biology 2019Quote: ... Matrix-assisted laser-desorption ionization time of flight mass spectrometry of the XyG oligosaccharides was recorded with a MALDI/TOF Bruker Reflex III using super-DHB (9:1 mixture of 2,5-dihydroxy-benzoic acid and 2-hydroxy-5- methoxy-benzoic acid; Sigma-Aldrich, sigmaaldrich.com) as matrix.
-
bioRxiv - Cell Biology 2022Quote: ... the dissociated cells were resuspended in the transduction medium (1 uL to 5 uL of lentivirus, 4 to 8 ug/ml Polybrane[STR-1003-G, Sigma Aldrich] ...
-
bioRxiv - Neuroscience 2023Quote: ... D-Cyc (D-4-amino-3-isoxazolidone, 20 μg/μl; Sigma-Aldrich), AP5 (2-amino-5-phosphonopentanoate ...
-
bioRxiv - Biophysics 2021Quote: ... were activated with 3-(trimethoxysilyl)propyl methacrylate (Sigma-Aldrich, Cat#6514) for covalent crosslinking with PAA gels ...
-
bioRxiv - Biophysics 2020Quote: ... 24μL of water and 1μL of 3- (Trimethoxysilyl)propyl methacrylate (Sigma). The water employed was double-distilled and it was degassed by flowing Argon for 5min.
-
bioRxiv - Bioengineering 2023Quote: ... with 2 v/v% 3-(trimethoxysilyl) propyl methacrylate) (TMSPA, Sigma-Aldrich). These modifications allowed for easy manipulation of the crosslinked hydrogels ...
-
bioRxiv - Bioengineering 2023Quote: ... and 3μL of 3-(Trimethoxysilyl)propyl methacrylate (Bind-silane; Sigma, M6514). Then ...
-
bioRxiv - Plant Biology 2020Quote: ... Trolox® (6- hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid, Sigma-Aldrich) solutions of known concentration ...
-
bioRxiv - Biophysics 2023Quote: ... Trolox (6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid; Sigma #238813-1G) was dissolved in 3.2 mL of HPLC grade water ...
-
bioRxiv - Physiology 2024Quote: ... hypothalamic tissue was homogenized in 100% methanol containing 1 mM 6-propyl-2-thiouracil (PTU) (Sigma, H34203) in a glass-glass tissue grind pestle (60mm ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl benzonase (Millipore, 71206-3) was added ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’, Sigma Aldrich). The siRNA for luciferase (siLuc ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’, Sigma Aldrich), siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8A (5’-GACAAGUUUCCAAGGAACGtt-3’, Sigma Aldrich), siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’, Sigma Aldrich), siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... or Tim29 (5’ GGCUCUUCGAUGAGAAGUA 3’) (Sigma). Briefly ...
-
bioRxiv - Immunology 2020Quote: ... with 3 mg 5-fluorouracil (Sigma). Bone marrow was collected after 4 days and cultured in DMEM containing 15% FBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... or 5 mM 3-MA (Sigma) were added during the 16-h incubation period ...
-
bioRxiv - Cell Biology 2023Quote: ... siSpindly (Sigma-Aldrich, 5′-GAAAGGGUCUCAAACUGAA-3′) for 48 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... siTTLL12_6: 5’- GGUUGUUCGUGUAUGAUGU-3’ (Sigma-Proligo).
-
bioRxiv - Biochemistry 2024Quote: ... K125E reverse: 5’-ttcgatgcggacctcctgggttttgatctc-3’ (Sigma) with the wild-type human connexin 26 pFast construct used for previous studies as the template for mutagenesis (Brotherton et al. ...
-
bioRxiv - Microbiology 2022Quote: ... polymyxin B sulfate and 2-Heptyl-3-hydroxy-4(1H)-quinolone (PQS) (Sigma-Aldrich Corp., St. Louis, MO) were dissolved in water ...
-
bioRxiv - Cell Biology 2023Quote: ... N-(6-Aminohexyl)-5-chloro-1-naphthalenesulfonamide hydrochloride (A3281, Sigma, MO, USA); 500nM ZSTK474 (S1072 ...
-
bioRxiv - Plant Biology 2023Quote: ... Spores were grown on solid 0.5× Gamborg B-5 media for 5 days and dispensed in 6-well plates containing 4 mL of liquid 0.5× Gamborg B-5 plus supplements: 0.1% N-Z amino A (Sigma #C7290) 0.03% (w/v ...
-
bioRxiv - Cell Biology 2022Quote: ... 1,2-dioleoyl-sn-glycero-3-phospho-(1’-myo-inositol-4’,5’-bisphosphate) (ammonium salt) (PI(4,5)P2) (Sigma 850155P), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC ...
-
bioRxiv - Cancer Biology 2023Quote: ... Standard curves for the experiment were generated using cis-4-Hydroxy-1-proline (Sigma) with stock solution 4 mg/mL and sequential dilution range from 400 ug/ml down to 1.5625 ug/ml.
-
bioRxiv - Cancer Biology 2021Quote: ... oxidative stress was reduced with 1 mM Trolox (6-Hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid, Sigma). For all the inhibitor experiments ...
-
bioRxiv - Cell Biology 2022Quote: ... BubR1 5’GAUGGUGAAUUGUGGAAUAdTdT3’) or luciferase (5’ CGUACGCGGAAUACUUCGAdTdT 3’) was synthesized from Sigma and used for the RNAi.
-
bioRxiv - Neuroscience 2022Quote: ... samples were incubated for 5 min with a 4’,6-diamidino-2-phenylindole (DAPI) solution (Sigma) to stain cell nuclei ...
-
bioRxiv - Physiology 2024Quote: ... samples were incubated with 5 µg/mL 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI, Sigma-Aldrich) in PBS ...
-
bioRxiv - Neuroscience 2024Quote: ... D-APV (D-(-)-2-amino-5-phosphonvaleric acid) (30 μM, Sigma), Gabazine (10 μM ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3-5 million cells were fixed with ∼1% formaldehyde (Sigma-Aldrich) for 10 min and lysed ...
-
bioRxiv - Molecular Biology 2020Quote: ... The rANF single strands DNAs (5’-AGAGGTCATGAAGGACATT-3’ and 5’AATGTCCTTCATGACCTCT-3’) were purchased from Sigma Aldrich and annealed ...
-
bioRxiv - Biochemistry 2020Quote: ... P4 5’ CTTGTCGTCATCGTCTTTGTAGTCCTTGTC 3’ and P5 5’ CAGGAAACA GCTATGACCATG 3’ and KOD Hot Start DNA Polymerase (Millipore).
-
bioRxiv - Cell Biology 2021Quote: ... CEP192 knockdown was achieved by transfecting the oligo duplex: 5’-GGAAGACAUUUUCAUCUCUtt-3’ and 5’-AGAGAUGAAAAUGUCUUCCtt-3’ (Sigma).