Labshake search
Citations for Millipore Sigma :
401 - 450 of 10000+ citations for 6H Imidazo 4 5 1 de acridin 6 one 5 3 diethylamino propyl amino 8 hydroxy since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Stock-X was mixed with 0.5% 4-Hydroxy-TEMPO (Sigma, 176141), 10% TEMED (Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.01% 4-hydroxy- TEMPO inhibitor solution (Sigma-Aldrich, catalog no. 176141), 0.2% ammonium persulfate (Sigma Aldrich ...
-
bioRxiv - Molecular Biology 2023Quote: ... and inducing with 100nM 4-hydroxy-tamoxifen (OHT; Sigma, H7904-5MG) after 48 hours.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: When the tumor sizes reached to 80 mm3 animals were treated with a PFKFB3 inhibitor 3-(3-pyridinyl)-1-(4-pyridinyl)-2-propen-1-one) (3PO) (Sigma-Aldrich, Merck, Overijse, Belgium). The animals received intraperitoneal (i.p. ...
-
bioRxiv - Microbiology 2019Quote: ... A 200 μL aliquot of a solution containing 100 μg/μL of XTT (2, 3-(2-methoxy-4-nitro-5-sulfophenyl)-5-[(phenylamino) carbonyl]-2H-tetrazolium hydroxide) (Sigma-Aldrich, St Louis, MO, USA) and 10 μg/μL of PMS (phenazine methosulfate ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.04 mg/ml catalase (EMD biosciences) and 1 mM 6-hydroxy-2,5,7,8-tetramethyl-chromane-2-carboxylic acid (Trolox) (Sigma Aldrich). After DNA was tethered on the surface ...
-
bioRxiv - Cell Biology 2019Quote: ... 6-8 min and 15 min post-activation with 4% paraformaldehyde (PFA, Sigma) diluted in microtubule stabilising buffer (MTSB ...
-
bioRxiv - Cell Biology 2019Quote: ... 6-8 min and 15 min post-activation with 4% paraformaldehyde (PFA, Sigma) diluted in microtubule stabilising buffer (MTSB ...
-
bioRxiv - Neuroscience 2021Quote: ... and 6-chloro-1,2-benzisoxazol-3(2H)-one (CBIO) were purchased from Sigma Aldrich. Phorbol 12-myristate 13-acetate was purchased from Cayman Chemical ...
-
bioRxiv - Microbiology 2022Quote: ... The hydrogel was then prepared by slowly adding 5 g hydroxy ethyl cellulose (Sigma Aldrich, St. Louis, Missouri, USA) under constant ...
-
bioRxiv - Cell Biology 2020Quote: ... RRID rabbit anti-p-SMAD1/5/8 (Cat#AB3848-I; Millipore Sigma; used 1:100), and rat anti-SCGB1A1 (R&D ...
-
bioRxiv - Neuroscience 2021Quote: ... The sections were counterstained with 5 μM 4’,6-diamidine-2’-phenylindole dihydrochloride (DAPI) (Sigma-Aldrich, Cat# D9542) in PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were incubated for 5 min with 10 μg/ml 4’,6-Diamidino-2-phenylindole (DAPI; Sigma-Aldrich) to stain cell nuclei ...
-
bioRxiv - Neuroscience 2022Quote: ... CAS# 614-96-0), 6-methylindole (97%, CAS# 3420-02-8) and 7-methylindole (97%, CAS# 933-67-5) were acquired from Sigma-Aldrich, and 4-methylindole (99% ...
-
bioRxiv - Cancer Biology 2019Quote: ... ADORA1 selective and competitive antagonists 1-Butyl-3-(3-hydroxypropyl)-8-(3-noradamantyl) xanthine (PSB36) and 8-cyclopentyl-1,3-dipropylxanthine (DPCPX) (Sigma-Aldrich); ADORA2b selective antagonist 4-(2,3,6,7-Tetrahydro-2 ...
-
bioRxiv - Neuroscience 2023Quote: ... testosterone-filled (4-androsten-17β-ol-3-one, Sigma Aldrich T-1500) Silastic tubes (2.16 OD x 1.02 ID ...
-
bioRxiv - Immunology 2020Quote: ... mosquitoes were kept at 26.0°C (± 0.5°C) in an ultrasonic humidity cabinet and provided with 8 % Fructose and 0.05 % 4-Aminobenzoic acid (both Sigma) feeding solution from this point forward ...
-
bioRxiv - Cell Biology 2021Quote: ... were reared in 10g/l of glucose/200µM of 3BDO (3-Benzyl-5-((2-nitrophenoxy) methyl)-dihydrofuran-2(3H)-one) (Sigma Aldrich) supplemented in standard fly food ...
-
bioRxiv - Microbiology 2023Quote: The small interfering RNAs (siRNAs) against NLRP3 (siNLRP3) (5’-UGCAAGAUCUCUCAGCAAA-3’) and the corresponding control siRNAs (siControl) (5’-UUCAAUAAAUUCUUGAGGU-5’) were synthesized from Sigma. The siGenome smart pool siRNAs and siON Target plus siRNAs were purchased from Dharmacon and are composed of a pool of four siRNAs ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmodium-specific forward and reverse primer (12.5 pmol; Plas-7F 5’-GTTAAGGGAGTGAAGACGATCAGA-3’ and Plas-171R 5’-AACCCAAAGACTTTGATTTCTCATAA-3’; Sigma-Aldrich), PhHV-specific forward and reverse primer (15 pmol ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and oligonucleotides recognizing both lacO (5′-CATGTGGAATTGTGAGCGGATAACAATTTGTGG-3′) and Gal4 (5′-TCGACGGAGGACAGTCCTCCG-3′) sequences labelled with Biotin were purchased (Sigma). Oligonucleotides were mixed at 100 ng/μL and resuspended in hybridization buffer (50% formamide ...
-
bioRxiv - Biochemistry 2020Quote: To examine the RNA binding mode of the N-NTD we used a commercially available 7mer RNA duplex that was prepared by annealing of RNA oligonucleotides 5’-CACUGAC-3’ and 5’-GUCAGUG-3’ (Sigma). The RNA oligonucleotides were mixed in a molar ratio 1:1 at the final concetration 200 μM of each oligonucleotide and water supplemented with 50 mM NaCl ...
-
bioRxiv - Neuroscience 2021Quote: ... HT22 cells were infected with lentivirus carrying the control scrambled-shRNA (5’-CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTTG-3’) or CB-specific shRNA (5’-CCGGGATTGGAGCTATCACCGGAAACTCGAGTTTCCGGTGATAGCTCCAATCTTTTTG-3’) with polybrene (Sigma) for two days ...
-
bioRxiv - Cell Biology 2021Quote: High performance liquid-chromatography-purified RNA oligonucleotides 5’-(UG)12-3’ and 5’-(UC)12-3’ were ordered from Sigma. The oligonucleotides were biotinylated using the Pierce RNA 3’ End Desthiobiotinylation kit (Cat n° 20163 ...
-
Competition co-immunoprecipitation reveals interactors of the chloroplast CPN60 chaperonin machinerybioRxiv - Molecular Biology 2023Quote: ... was PCR amplified from cDNA clone AV639302 (Kazusa) with oligos 5’-GCCAGGATCCGGAGAATTTATACTTCCAGGGTGCTACCCCCGTGCCCAAG-3’ and 5’-CGCGCGAAGCTTTTACGAGAGCTGGGCCAGG-3’ and cloned with BamHI and HindIII into petDUET (Novagen), giving pFW21 ...
-
bioRxiv - Plant Biology 2023Quote: ... Designed primers included standard FAM or HEX compatible tails (FAM tail: 5’ GAAGGTGACCAAGTTCAT-GCT 3’; HEX tail: 5’ GAAGGTCGGAGTCAACGGATT 3’ (Sigma)) Table S2) ...
-
bioRxiv - Cell Biology 2023Quote: ... AID Full Length F 5’-CCCAAGCTTATGGGCAGTGTCGAGCTG-3’ AID 1-114 F 5’-CCCAAGCTTATGGCAGTGTCGAGCTGAATC-3’ AID 31-114 F 5’-CCCAAGCTTAGAGGGTTCTCAGAGACGGTTG-3’ AID 71-114 F 5’-CCCAAGCTTAAAGATCCAGCCAAACCTCC-3’ AID R 5’-AAGGAAAAAAGCGGCCGCTACCTTCACGAACG-3’ PCR products were cloned into p3xFLAG-CMV10-PP6c construct (Sigma) using restriction digests and sequence confirmed ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 nM siRNA against DDX3X (5’-CCUAGACCUGAACUCUUCAGAUAAU dTdT-3’) or 20 nM siRNA against GRSF1 (5’-GUGCCUCUCUGCUGCCGCAdTdT-3’) which were synthesized by Sigma. Cells were subsequently incubated at 37 °C for 48 h before harvesting and analysis ...
-
bioRxiv - Immunology 2020Quote: ... 50 μl of antibody exposed to hemin or hemin in PBS only were mixed with 150 μl of reaction buffer (0.15 M citrate-phosphate buffer pH 5) containing 0.9 mM of 2,2-Azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS, Sigma-Aldrich) and 6 mM H2O2 ...
-
bioRxiv - Immunology 2023Quote: ... 5 ml of PBS and 5 ml of 4% Dextran (Sigma-Aldrich, 31392-50G) in PBS (Gibco ...
-
bioRxiv - Genomics 2019Quote: ... and 3 × 10−5 mM hydrocortisone (Sigma H0888) in 6 well plates (Figure 1) ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 h with 5 µM cucurbitacin E (Sigma), 1 h with 50 µM CK666 (Bio-Techne ...
-
bioRxiv - Cell Biology 2021Quote: ... or HSF1 (sense strand: 5’-CGGAUUCAGGGAAGCAGCUGGUGCA-3’, Sigma) were used ...
-
bioRxiv - Cell Biology 2020Quote: ... or siRNA targeting Tim22 (5’ CCAUUGUGGGAGCCAUGUU 3’) (Sigma) or Tim29 (5’ GGCUCUUCGAUGAGAAGUA 3’ ...
-
bioRxiv - Microbiology 2023Quote: ... and the Uni12 primer (5’-AGCAAAAGCAGG-3’, Sigma). For mRNA analysis Oligo(dT ...
-
bioRxiv - Cancer Biology 2021Quote: ... or 3-(1,3-Benzodioxol-5-ylmethylene)-2-oxo-1-pyrrolidinecarboxaldehyde (KNK437, Sigma Aldrich) for 24 hours prior to collection of cells for RNA extraction.
-
bioRxiv - Pathology 2023Quote: ... washed in TBS (3 × 5 min) and blocked in 1% BSA (Sigma Aldrich) in TBST (0.1% Tween-20 in TBS) ...
-
bioRxiv - Cell Biology 2022Quote: The tissue section on the Stereo-seq chip (5 cm x 3 cm or 2 cm x 3 cm) was then incubated at 37°C for 5-8 min and subsequently fixed in methanol (Sigma, 34860 ...
-
bioRxiv - Cell Biology 2021Quote: ... Cycloheximide (100 μg/ml, 6h, Sigma), Puromycine (1 μg/ml,2h ...
-
bioRxiv - Microbiology 2019Quote: ... MH agar was supplemented with 100 μg/mL XS (5-bromo-4-chloro-3-indolylsulfate (Sigma-Aldrich)) with or without 0.35 μg/mL anhydrotetracycline (ATc ...
-
bioRxiv - Biochemistry 2022Quote: ... pLANT-2/RIL–RFC[1+5] was co-transformed with pET(11a)-RFC[2+3+4] into BLR(DE3) cells (Novagen, Madison, Wisconsin). The cell lysate was clarified by centrifugation ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were passaged at 1/8 ratio every 3 or 4 days with Accumax (Millipore, ref. SCR006).
-
bioRxiv - Physiology 2022Quote: ... propyl gallate (Sigma-Aldrich), and resveratrol (Cambridge Chemical) ...
-
bioRxiv - Zoology 2019Quote: ... propyl acetate (Sigma-Aldrich, Cat ...
-
bioRxiv - Neuroscience 2021Quote: ... one PBS wash for 5’ and embedded in Fluorsave (Millipore, 2848323).
-
bioRxiv - Biochemistry 2022Quote: ... Purified proMMP-3 and mutants were activated for 16 h in the presence of 1 mM 4-amino-phenyl mercuric acetate (Sigma) at 37 °C ...
-
bioRxiv - Microbiology 2022Quote: ... 3-amino-9-ethylcarbazol (3-AEC; Sigma Aldrich, Germany) was used as a chromogen ...
-
bioRxiv - Microbiology 2021Quote: ... 3-Amino-1,2,4-triazole (3-AT, A8056, Sigma Aldrich). Bovine liver catalase (C1345 ...
-
bioRxiv - Neuroscience 2020Quote: Human cofilin1 was amplified by PCR using specific oligonucleotides (forward: 5’-CATATGGCCTCCGGTGTG-3’, reverse: 5’-GGATCCTCACAAAGGCTTGCCCTC-3’) and cloned into the pET-15b vector (Novagen, Millipore, UK). By using site-directed mutagenesis ...
-
bioRxiv - Biophysics 2021Quote: ... was performed using a pre-annealed DNA-RNA template (DNA45: 5’-TTCTTT ATCTCTTATTTCCTTCTATTTTCCACGCGCCTTCTATTT-3’; RNA13: 5’-[6FAM]-GGCGCGUGGAAAA-3’, Sigma Aldrich). The reaction buffer comprised 25 mM HEPES pH 7.2 ...