Labshake search
Citations for Millipore Sigma :
451 - 500 of 10000+ citations for 6H Imidazo 4 5 1 de acridin 6 one 5 3 diethylamino propyl amino 8 hydroxy since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... KO2 along with Cas9 donor plasmid were used as template DNA and amplified with F 5’-GAAGAAGAATGGCCTGTTCG-3’ and R 5’-GCCTTATCCAGTTCGCTCAG-3’ with KOD Xtreme (Novagen, #71975). Cycling conditions were as follows ...
-
bioRxiv - Cancer Biology 2022Quote: ... 53 from the RNAi Consortium (clones TRCN0000087290 and TRCN0000087292 with target sequence 5’-GCGGGAGTATAGTGAGTTTAA-3’ and 5’-CGGACAGTTTGGCACAATCAA-3’, respectively, distributed by Sigma-Aldrich, Merck ...
-
bioRxiv - Microbiology 2023Quote: ... The bacterial DNA was used to amplify the entire 16S region by PCR [5′-AGAGTTTGATCCTGGCTCAG-3′ (forward) and 5′-AAGGAGGTGATCCAGCCGCA-3′ (reverse)] using Expand High-Fidelity Polymerase (Sigma-Aldrich). The PCR products were purified using the QIAquick PCR Purification kit (Qiagen) ...
-
bioRxiv - Cell Biology 2022Quote: ... slides were washed in PBS and incubated in 5 μg/ml 4’,6-diamidino-2-phenylindole (DAPI) (Sigma Aldrich) in PBS for 5 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... slides were washed in PBS and incubated in 5 μg/ml 4’,6-diamidino-2-phenylindole (DAPI; Sigma Aldrich) in PBS for 5 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... slides were washed in PBS and incubated in 5 μg/ml 4’,6-diamidino-2-phenylindole (DAPI) (Sigma Aldrich) in PBS (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... immediately followed by a coating of 3- (trimethoxysilyl)propyl methacrylate (TMS) (Sigma-Aldrich, USA) to methacrylate the glass surfaces (Guvendiren et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... coated with 3-(trimethoxysilyl)propyl methacrylate (Sigma-Aldrich, Cat#6514, as per commercial protocol). Small volumes (e.g. ...
-
bioRxiv - Biophysics 2023Quote: ... they were incubated with NaOH 0.1M and (N-[3(Trimethoxysilyl)propyl]ethylenediamine) (Sigma Merck) for 3 minutes each step ...
-
bioRxiv - Cell Biology 2024Quote: ... was added to a solution of 3-(Trimethoxysilyl) propyl methacrylate (M6514-25ML; Sigma-Aldrich) in ethanol (E7023-500ML ...
-
bioRxiv - Neuroscience 2022Quote: ... Imaging buffer containing 2 mM 6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid (Trolox, Sigma), 5mM 3,4-Dihydroxybenzoic acid (DBA ...
-
bioRxiv - Neuroscience 2022Quote: ... and 0.1 mM Trolox (6-Hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid; Sigma, Cat# 238813). The cultures were kept at 35 °C during the imaging procedure ...
-
bioRxiv - Biochemistry 2023Quote: ... Twelve mM Trolox (6-hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid, Sigma-Aldrich; 238813-1G) solution was prepared as described previously by adding 60 mg of Trolox powder (238813-5G ...
-
bioRxiv - Biophysics 2024Quote: ... Twelve mM Trolox (6-hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid, Sigma-Aldrich; 238813-1G) solution was prepared as described previously3 by adding 60 mg of Trolox (238813-5G ...
-
bioRxiv - Biochemistry 2020Quote: ... HLCs were exposed to either 5-Aminoimidazole-4-carboxamide-1-β-D-ribofuranosyl 5′-monophosphate (AICAR; 1mM; Sigma-Aldrich, A1393-50MG), O-(Carboxymethyl)hydroxylamine hemihydrochloride (AOA ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... For autophagy inhibitors treatment, 3-methyladenine (3-MA, 5 mM) (Sigma-Aldrich), bafilomycin A1(Baf ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Chk1 (3’Chk1) (5’CUGGUGAAUAUAGUGCUGCUA3’ from Sigma-Aldrich), Polι (SMART pool ...
-
bioRxiv - Molecular Biology 2019Quote: ... From the beginning of the incubation time medium was supplemented with the ROS inhibitor Tempol (4-hydroxy-2,2,6,6-tetramethylpiperidin-1-oxyl)) (1mM, 176141-1G, Sigma), the collagenase inhibitor Ilomastat ((R)-N′-Hydroxy-N-[(S)-2-indol-3-yl-1-(methylcarbamoyl)ethyl]-2-isobutylsuccinamide ...
-
bioRxiv - Cell Biology 2022Quote: ... diluted in TRIS-Glycerol (5% v/v TRIS 1 M pH 8 in Glycerol, Sigma Aldrich). This composition has been previously shown to produce comparable ...
-
bioRxiv - Microbiology 2022Quote: Adherent neutrophils (not IL-8 treated) were exposed to 5 µg mL−1 cytochalasin B (Sigma) for 20 min followed by 1 µM fMLF (Sigma ...
-
bioRxiv - Immunology 2021Quote: PBMCs and tissue MNC suspensions were treated with 5 μM Chk2 inhibitor II or 2-[4-(4-chlorophenoxy)phenyl]-1H-benzimidazole-5-carboxamide (Sigma) prepared in final volume of 1% bovine serum albumin (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... Fluorescein 5(6)-isothiocyanate (FITC) were purchased from Sigma Aldrich. IgG-AlexaFluor555 from Abcam ...
-
bioRxiv - Cancer Biology 2019Quote: 6-Diazo-5-oxo-L-norleucine (Don, D2141, Sigma, UK); Sodium dichloroacetate (DCA ...
-
bioRxiv - Biochemistry 2023Quote: ... and FAM (5(6)-carboxyfluorescein) were purchased from Sigma-Aldrich. D-biotin was purchased from GoldBio ...
-
bioRxiv - Bioengineering 2020Quote: ... 2-hydroxy-4’-(2-hydroxyethoxy)-2-methylpropiophenone (Irgacure 2959, 410896, Sigma Aldrich), VEGF specific control aptamer (47-nt ...
-
bioRxiv - Neuroscience 2019Quote: ... N,N,N′,N′-Tetramethylethylenediamine (Roth) and 4-Hydroxy-TEMPO (Sigma-Aldrich) to MS ...
-
bioRxiv - Neuroscience 2023Quote: ... 4-Hydroxy-TEMPO (4HT; #176141) was purchased from Sigma (Saint Louis, MO).
-
bioRxiv - Bioengineering 2023Quote: ... was coated with a 4:1:5 v/v/v collagen IV (Sigma) / fibronectin (Sigma ...
-
bioRxiv - Molecular Biology 2023Quote: 50 nM of Bortezomib (Selleckchem, Boston, USA) and 5 µM of PD169316 (Sigma Aldrich, Seelze, DE) was used to inhibit and induce proteasome ...
-
bioRxiv - Developmental Biology 2024Quote: ... De-encapsulated testes were digested for 5 min in 0.5 mg/mL collagenase (Clostridium histolyticum, Sigma), then treated for 10 min with Trypsin (Acetylated from bovine pancreas ...
-
bioRxiv - Plant Biology 2019Quote: ... AGM was supplemented with vitamins (Duchefa M0409), cytokinin (200 nM 6-Benzylaminopurine), and IAA (3-indole acetic acid, 1 mM) and/or Trichostatin A (TSA, Sigma, T8552, final concentration 5 µM) or mock before pouring ...
-
bioRxiv - Neuroscience 2021Quote: ... sample from the overnight cleavage step was concentrated to ∼5 mg/ml and injected into the Superose 6 Increase column equilibrated in SEC buffer with 1 mM DEET (Sigma Aldrich, CAS#134-62-3). Peak fractions were concentrated to ∼5 mg/ml and used immediately for grid preparation.
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mM 4-thiouracil (4tU) (Sigma, 440736-1G) was added to each condition during the final 6 minutes of auxin treatment ...
-
bioRxiv - Biochemistry 2024Quote: ... 5-aminoimidazole-4-carboxyamide-ribonucleoside (Z) (Millipore Sigma) in DMSO was used ...
-
bioRxiv - Biochemistry 2023Quote: ... MWCO 6-8 kDa (Millipore). BRD4Tandem (residues 43-459 ...
-
bioRxiv - Immunology 2021Quote: Blood was extracted from hBLT mice at 3 and 5-6 weeks post-infection and lysed with Red Blood Cell Lysis Buffer (SIGMA). T cells were activated for 1.5 h with 5μl/ml of anti-CD28 and anti-CD49d in the presence or absence of 6.4μg/ml of a Gag pool of peptides in the presence of 0.5μg/ml Brefeldin A ...
-
bioRxiv - Immunology 2020Quote: ... Cells were then treated with 6-thio-dG (3-5 μM) in the presence of 500 ng/ml doxycycline (Sigma), washed three times with warm PBS and allowed to recover in regular growth medium containing 500 ng/ml doxycycline ...
-
bioRxiv - Plant Biology 2024Quote: ... meliloti 1021 (pXLGD4) strain were stained using 5-bromo-6-chloro-3-indolyl-β-d-galactopyranoside (Magenta-Gal, Sigma-Aldrich), according to the protocol described previously by Jarzyniak et al ...
-
bioRxiv - Plant Biology 2019Quote: ... raised against gel-purified ATLP1 using alkaline phosphatase(AP)-conjugated goat anti-rabbit IgG (1:10000 dilution) as the secondary antibody and 5-bromo,4-chloro,3-indolylphosphate(BCIP)/nitroblue tetrazolium (NBT)(Sigma Chemical Co. MS) as the substrates (Safadi et al. ...
-
bioRxiv - Cancer Biology 2024Quote: ... crypts generated from transgenic mice were incubated with 500nM 4-hydroxy-tamoxifen (4-OHT) (Millipore, 579002) dissolved in 100% EtOH (test) ...
-
Transport of metformin metabolites by guanidinium exporters of the Small Multidrug Resistance familybioRxiv - Biophysics 2023Quote: ... 100 mM KCl and pre-loaded with 0.4 mM substrate (Gdm+ or guanylurea) and 1mM pyranine (trisodium 8-hydroxypyrene-1, 3, 6-trisulfonate; Sigma-Aldrich) using three freeze/thaw cycles ...
-
bioRxiv - Molecular Biology 2019Quote: ... in second attempt we used the library consisted of 8 random nucleotides with fixed G in the middle position: 5’-GCTCAAGCTTACTGCAGATATNNNNGNNNNTTTAGGATCCATCTAGAGTCCGA- 3’(SIGMA-ALDRICH). 15µg of the library were made double-stranded with 5µg 3’ primer (CAST1_R- ACTCTAGATGGATCCTACG or CAST2_R-TCGGACTCTAGATGGATCCTA ...
-
bioRxiv - Cancer Biology 2023Quote: Dissected tumors were washed in PBS and homogenized at room temperature in urea lysis buffer (8 M urea, 40 mM Tris pH 7.6, 5% SDS supplemented with phosphatase inhibitor cocktails 2, 3 (Sigma P5726, P0044)) ...
-
bioRxiv - Microbiology 2020Quote: Total intracellular and extracellular ROS was measured by luminol (5-amino-2,3-dihydro-1,4-phthalazinedione; 1 mM; Sigma-Aldrich) enhanced chemiluminescence as previously described [14] ...
-
bioRxiv - Immunology 2019Quote: ... inhibitors on the autophagic flux pathways (3-MA, 5 μM, Sigma-Aldrich; chloroquine, 5 μM, Sigma-Aldrich; bafilomycin, 5 μM, Sigma-Aldrich), and inhibitors on the mTOR pathway (Rapamycin ...
-
bioRxiv - Immunology 2019Quote: ... inhibitors on the autophagic flux pathways (3-MA, 5 μM, Sigma-Aldrich; chloroquine, 5 μM, Sigma-Aldrich; bafilomycin, 5 μM, Sigma-Aldrich), and inhibitors on the mTOR pathway (Rapamycin ...
-
bioRxiv - Microbiology 2020Quote: ... 1 mg ml-1 of 3–5 kDa fluorescein isothio-cyanate (FITC)-dextran (Sigma-Aldrich, Germany) in phenol-red free DMEM/F12 medium (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2020Quote: ... cells were infected with pLKO.1 control or pLKO.1-shZSCAN4 (5’-GAATGCAACAACTCTTGTAATCTCGAGATTACAAGAGTTGTTGCATTCT-3’, Millipore Sigma) and further selected with Puromycin (1ug/ml ...
-
bioRxiv - Bioengineering 2021Quote: Before staining with either 5-bromo-4-chloro-3′-indolyphosphate and nitro-blue tetrazolium (BCIP/NBT, Sigma-Aldrich) for alkaline phosphatase (ALP ...
-
bioRxiv - Developmental Biology 2019Quote: ... embryos were developed using nitroblue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl-phosphate (NBT/BCIP) (Sigma) in staining buffer (100 mM Tris pH9.5 ...