Labshake search
Citations for Millipore Sigma :
151 - 200 of 10000+ citations for 6H Imidazo 4 5 1 de acridin 6 one 5 3 diethylamino propyl amino 8 hydroxy since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... the NMDA glutamate receptor antagonist [3H]3-(2-carboxypiperazin-4-yl) propyl-1-phosphonic acid (CPP, 10 μM, Sigma-Aldrich) and a selective group III metabotropic glutamate receptor agonist ...
-
bioRxiv - Cell Biology 2020Quote: ... 100 nM 4-hydroxy Tamoxifen (4 OT, Sigma, H7904) for 7 days was added on budding large organoids.
-
bioRxiv - Cancer Biology 2022Quote: ... Treatment with 1.5μl 4 hydroxy tamoxifen (4-HT) (Sigma) (8 mg/ml) ...
-
bioRxiv - Immunology 2023Quote: ... and 50 nM 4-hydroxy-tamoxifen (4-OHT) (Sigma) and re-fed at day 3 ...
-
bioRxiv - Neuroscience 2022Quote: ... L-2-amino-5-phosphonovaleric acid (AP5, Sigma) were included ...
-
bioRxiv - Cell Biology 2022Quote: ... followed immediately by an equal volume of a freshly-prepared 5 mg/mL solution of 4-hydroxy-α-cyano-cinnamic acid (Sigma) in 50% aqueous (v:v ...
-
bioRxiv - Developmental Biology 2020Quote: ... 0.5 mM 8-bromoadenosine 3□,5□-cyclic monophosphate (Sigma-Aldrich, Saint Louis, MO, USA), 1 μM medroxyprogesterone acetate (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 100 nM 8- Bromoadensoine 3’,5’-cyclic monophosphate sodium salt (Sigma, Cat#B7880) was added ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.2% trans-1-acetyl-4-hydroxy-l-proline (Sigma-Aldrich, 441562) and 0.05% sodium azide (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were mounted after 4′,6-diamidino-2-phenylindole (DAPI) staining (1:5 000, Sigma-Aldrich, USA). Confocal images were captured under 20× objective using A-1R Confocal Microscope (Nikon ...
-
bioRxiv - Cell Biology 2019Quote: ... 0.01% 5-(6)-6-carboxyfluorescein diacetate (CFDA; Sigma) and apoplastic tracer ...
-
bioRxiv - Physiology 2023Quote: ... glycogen phosphorylase was inhibited by IV (jugular vein) injection of 1-(3-(3-(2-Chloro-4,5-difluorobenzoyl)ureido)-4-methoxyphenyl)-3-methylurea (Sigma, 5 mg/kg) one hour prior to the start of a tracer infusion ...
-
bioRxiv - Immunology 2021Quote: ... or 400µg NP-PCC (4-hydroxy-3-nitrophenylacetyl (Biosearch) conjugated to pigeon cytochrome C (Sigma)) mixed with adjuvant based on Monophosphoryl Lipid A ...
-
bioRxiv - Microbiology 2022Quote: ... and 2-Heptyl-3-hydroxy-4(1H)-quinolone (pqs, Sigma-Aldrich CAS# 108985-27-9) alone and in combination ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mM 2-amino-5-phosphonopentanoic acid and 100 U/ml DNase (DN25, Sigma) for 25 min ...
-
bioRxiv - Bioengineering 2023Quote: ... and 4-Hydroxy-TEMPO (Sigma, Cat# 176141), diluted with PBS ...
-
bioRxiv - Developmental Biology 2024Quote: ... 10 mg of 4–hydroxy Tamoxifen (Sigma) was dissolved in 1 ml of absolute ethanol and 9 ml of corn oil (Sigma ...
-
bioRxiv - Neuroscience 2021Quote: Brain samples were embedded in 4-5% agarose (Sigma-Aldrich: 9012-36-6) in 0.1M PB and imaged using serial two-photon tomography (Han et al 2018 ...
-
bioRxiv - Plant Biology 2019Quote: 7-Diethylamino-4-methylcoumarin (Sigma D87759-5G, 50 mg/ml in DMSO)
-
bioRxiv - Neuroscience 2021Quote: ... antisense: 5’-ACCGAUUGAAGUUAAUGUC-3’), Myef2 (sense: 5’-CUUUGGUGGAGUUGGCCGA-3’, antisense: 5’-UCGGCCAACUCCACCAAAG-3’) or siRNA universal negative control (SIC001, Sigma-Aldrich) were purchased from Sigma-Aldrich ...
-
bioRxiv - Systems Biology 2020Quote: BALB/cJ mice were subjected to cutaneous Oxazolone (Oxa) challenge by applying 5% 4-Ethoxymethylene-2-phenyl-2-oxazolin-5-one (Sigma-Aldrich) in acetone and olive oil topical to the skin as described [74] ...
-
bioRxiv - Cell Biology 2022Quote: ... at passages 4-5 were cultured on Millicell EZ 8-well glass slides (Millipore) pre-coated with gelatin (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... coated with gas- phase 3-(trimethoxysilyl)propyl methacrylate (Sigma), and baked at 120°C for 1 h ...
-
bioRxiv - Cell Biology 2022Quote: ... Sin1 (3-(4-5 Morpholinyl) sydnone imine hydrochloride (Sigma-Aldrich, Cat-M5793). Media products MEM and F12 (ratio 1:1) ...
-
bioRxiv - Microbiology 2019Quote: ... and primers p181 (5’-GCGAAGATAACAGTGACTCTA-3’ and p54 (5’-CGGCTCTGATTAAATTCTGAAG-3’) (Sigma, UK).
-
bioRxiv - Cell Biology 2023Quote: ... 5’CGUACGCGGAAUACUUCGA[dU][dU]3’) and Cofilin-1 (5’CCUCUAUGAUGCAACCUAU[dU][dU]3’)[78] have been synthetized by Sigma. In rescue experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... 3-dione (CNQX) and 50 mM D,L-2-amino-5-phosphonovaleric acid (APV) acquired from Sigma to suppress post-synaptic responses ...
-
bioRxiv - Neuroscience 2023Quote: ... We also used (±) 8-hydroxy-2- (dipropylamino)tetralin hydrobromide (8-OH-DPAT; 30nM, SIGMA) and Apamin (20nM ...
-
bioRxiv - Neuroscience 2024Quote: ... 4-hydroxy-tamoxfen (4-OHT) was purchased from Sigma (H6728) and was dissolved in 100% DMSO and stored in the -20 until use ...
-
bioRxiv - Cancer Biology 2023Quote: ... Tissue slides were mounted in glycerol / n-propyl gallate medium (4% n-propyl gallate (02370, Sigma-Aldrich), 8 ml 100% glycerol ...
-
bioRxiv - Bioengineering 2022Quote: ... and dried under compressed air before coating one slide surface with a layer of 3-(trimethoxysilyl)propyl methacrylate (440159, Sigma) and acetic acid in deionized (DI ...
-
bioRxiv - Cell Biology 2019Quote: ... or the Kv7 channel activator retigabine (10−8 M to 3·10−5 M, Sigma). Some PAs were treated with XE991 (3·10-8-3·10-6 ...
-
bioRxiv - Cell Biology 2021Quote: ... Sig8-bromoadenosine 3′,5′-cyclic monophosphate sodium salt (8-Br-cAMP, Sigma-Aldrich, Darmstadt, Germany) at 0 hpi to a final concentration of 0.2 mM ...
-
bioRxiv - Cell Biology 2019Quote: ... Some PAs were treated with XE991 (3·10-8-3·10-6, Sigma) before the stimulation with 5-HT and then the relaxation induced by SNP was tested.
-
bioRxiv - Developmental Biology 2019Quote: ... Tissue was suspended in cold methanol with 1 mM 6-propyl-2-thiouracil (PTU; Sigma) and homogenized by sonication ...
-
bioRxiv - Neuroscience 2020Quote: ... 2-amino-5-phosphonovaleric acid (APV) (Sigma, A8054, USA), AMPA/kainate receptor antagonist 6-Cyano-7-nitroquinoxaline-2 ...
-
bioRxiv - Neuroscience 2020Quote: DL-2-Amino-5-phosphonopentanoic acid (APV, Sigma A5282) was dissolved in saline to reach a final concentration of 5 μg/ μL ...
-
bioRxiv - Immunology 2022Quote: ... 5 ml MEM non-essential amino acids (Sigma Aldrich), 1 mM Na-Pyruvate (Gibco) ...
-
bioRxiv - Immunology 2022Quote: ... 5 ml MEM non-essential amino acids (Sigma Aldrich), 1 mM Na-Pyruvate (Gibco) ...
-
bioRxiv - Biochemistry 2020Quote: ... then visualized using 400 μL 8 mg/mL 3-amino-9-ethylcarbazole (Sigma) in 10 mL 50 mM sodium acetate (Fisher ...
-
bioRxiv - Microbiology 2023Quote: ... and 2-heptyl-3-hydroxy-4-quinolone (PQS) were obtained from Sigma Aldrich (St. Louis, MO). Triton X-100 and Tween-20 were used at 0.2% and 2% ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 8-(4-chlorophenylthio) adenosine-3’,5’-cyclic monophosphate (CPT-cAMP; PKA activator) or PMA (PKC activator)) were purchased from Sigma-Aldrich (ON, Canada). Powdered CBD ...
-
bioRxiv - Developmental Biology 2023Quote: ... The growth medium of organoids was supplemented with 100μM with 8-Bromoadenosine 3’,5’-cyclic monophosphate sodium salt (8-Br-cAMP) (Sigma, #B7880) in iPSC organoids or 200μM forskolin (FSK ...
-
bioRxiv - Cell Biology 2020Quote: ... or 5-Aza (6 μM, Sigma) into L-ESCs culture medium.
-
bioRxiv - Immunology 2021Quote: ... in the presence of 4-amino-5 methylamino-2’ s,7’-difluorofluorescein (DAF-FM) diacetate (Sigma, D1946). DAF fluorescence intensities were measured every 5 minutes for a total of 60 minutes using a SpectraMax iD3 (Molecular Devices) ...
-
bioRxiv - Biochemistry 2023Quote: ... then with 4 mM N-propyl maleimide (Millipore Sigma) for 1-2 h at 37 °C to block reactive cysteines and prevent on-gel disulfide crosslinking ...
-
bioRxiv - Biophysics 2020Quote: ... the following target sequences were used: 5’-GCTTCAGGATTCAATGCCATGG-’3 (#1) using the all-in-one CRISPR/Cas9 plasmid (Sigma-Aldrich) followed by cell-sorting for GFP expression to generate single cell clones with disrupted ANXA4 reading frame.
-
bioRxiv - Cancer Biology 2023Quote: ... des-Arg9-Leu8]-BK (B1R antagonist) and 3-(5′-Hydroxymethyl-2′-furyl)-1-benzyl indazole were purchased from Sigma-Aldrich (St. Louis, MO, USA). 8-Bromoguanosine 3′ ...
-
bioRxiv - Genomics 2019Quote: ... with primers 5’ GAGCTGGACGGCGACGTAAACG 3’ and 5’ CGCTTCTCGTTGGGGTCTTTGCT 3’ for amplification (Sigma-Aldrich, Germany). The PCR amplification was as follows ...
-
bioRxiv - Immunology 2022Quote: ... 15 μM 4-Hydroxy-TEMPO (TEMPOL, Sigma-Aldrich), 10/20 μM BAPTA-AM (Abcam) ...