Labshake search
Citations for Millipore Sigma :
2851 - 2900 of 5488 citations for IL 8 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... amplified off of phenol-extracted followed by ethanol precipitated whole-worm gDNA (Phenol pH 8 from Sigma Aldrich), using the primers KLB163 (AGACGCGGCCGCCGCGGGAGTACTTTACGGG ...
-
bioRxiv - Neuroscience 2022Quote: ... amplified off of phenol-extracted followed by ethanol precipitated whole-worm gDNA (Phenol pH 8 from Sigma Aldrich), using the KLB161 (AGACGCTAGCGAACTTTTTTCTTCTAATTTTTTGA ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4°C) and resuspended in B cell medium supplemented with 8 μg/mL polybrene (#TR-1003, EMD Millipore) at a density of 2×106 cells/mL ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... These fragments were homogenized by placing them in 2.0 mL screw-cap tubes containing a single 3.0 mm and 8 1.5 mm stainless steel beads and shaking them in a BeadBugmicrotube homogenizer (#Z763713, Sigma) for 120 seconds at a speed setting 3500 rpm ...
-
bioRxiv - Cell Biology 2023Quote: ... Atg3 KO MEFs were treated with the retrovirus containing medium and 8 μg/mL polybrene (Sigma- Aldrich, H9268). After 2 days ...
-
bioRxiv - Biochemistry 2023Quote: ... pH 8) and concentrated to 30 mg/ml using an Amicon Ultra-15 Centricon (Millipore Merck, Darmstadt, Germany). Crystallization experiments were performed with ORYX8 pipetting robot (Douglas Instruments ...
-
bioRxiv - Cancer Biology 2022Quote: Sucrose gradient fractionation was performed by first layering sucrose (8%, 30%, 45%, and 60% w/v; Sigma-Aldrich) in PBS (pH 7.4) ...
-
bioRxiv - Physiology 2023Quote: ... NRVM were treated for 24 h or 8 h with isoproterenol 100µmol/L (Isoprenaline hydrochloride, I5627, Sigma-Aldrich), 6-aminonicotinamide 2.5mmol/L (A68203 ...
-
bioRxiv - Neuroscience 2023Quote: ... Retinas were continuously superfused (∼8 mL/min) with oxygenated (95% O2, 5% CO2) bicarbonate-buffered Ames solution (Sigma) maintained at 25°C–28°C.
-
bioRxiv - Developmental Biology 2024Quote: ... 8-cell and morula stage embryos were obtained by flushing the oviduct with M2 medium (Sigma-Aldrich # M7167) by inserting a fine needle through the infundibulum and collecting the embryos ...
-
bioRxiv - Cell Biology 2024Quote: ... falciparum cultures (4-8 hpi) were treated with apicoplast inhibitors (either 5 µM clindamycin (Sigma-Aldrich, PHR 1159) for > 50 times the delayed death IC₅₀ ...
-
bioRxiv - Molecular Biology 2023Quote: ... Pellets were dissolved in 2X loading buffer (8 M urea with bromophenol blue dye (Sigma-Aldrich, #B0126-25G)) and run on a 10% urea PAGE gel at 16 W for 45 min ...
-
bioRxiv - Bioengineering 2023Quote: ... (in mM as follows: 37 NaCl, 2.7 KCl, 8 Na2HPO4, 1.4 KH2PO4; pH 7.2; all chemicals from Sigma-Aldrich)149 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were transduced in RPMI supplemented with 10% FBS and 8 μg/ml protamine sulfate (P4020, Sigma Aldrich). Virus was added at a MOI 5 and a spinoculation step (centrifugation x1000g at 32°C for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 10 % (v/v) glycerol) by using a D-Tube Dialyzer with MWCO 6-8 kDa (Millipore, #71507-M) for 16 h at 4 °C ...
-
bioRxiv - Microbiology 2023Quote: ... mixed with ∼5 x 105 Jiyoye cells in the presence of 8 µg/ml polybrene (Sigma-Aldrich/Merck) and spun at 800 g for 2 h ...
-
bioRxiv - Plant Biology 2023Quote: ... were either stored frozen at –80°C or resuspended in 1 ml of 8 M guanidine HCl (Sigma) in refolding buffer (250 mM NaCl ...
-
bioRxiv - Cancer Biology 2023Quote: ... and resuspended in 9.5 ml GBSS containing 0.3% bovine serum albumin (BSA) and 8 ml 28.7% Histodenz solution (Sigma-Aldrich) to reach an approximate density of 1.070 ...
-
bioRxiv - Biochemistry 2024Quote: ... These cells were transduced with the lentiviral particles using Polybrene (8 μg/ml; Sigma-Aldrich TR-1003-G). Puromycin (Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... the fermented PKM was mixed with 8 ml phosphate-buffered saline (PBS) followed by filtration through miracloth (Sigma) to remove PKM debris and collect bacterial cells for RNA extraction ...
-
bioRxiv - Synthetic Biology 2024Quote: ... the fermented PKM was mixed with 8 ml phosphate-buffered saline (PBS) followed by filtration through miracloth (Sigma) to remove PKM debris and collect bacterial cells for RNA extraction ...
-
bioRxiv - Developmental Biology 2024Quote: ... and non-mitochondrial respiration was measured following injection of 6.25mM sodium azide (Sigma-Aldrich, CAS 26628-22-8). Basal OCR was measured for 8 cycles ...
-
bioRxiv - Neuroscience 2024Quote: ... 8-week-old C57BL/6J mice received an intraperitoneal injection of 75 mg/kg methimazole (MMZ (EMD Millipore)) ...
-
bioRxiv - Immunology 2024Quote: The enzymatic activity of the cultures after exposures +/-CAS was determined using the WST-8 assay (96992; Sigma). Culture medium in the OrganoPlate was replaced with 25 µL WST-8 solution diluted 1:11 in assay medium in each in- and outlet of the top and bottom perfusion channel ...
-
bioRxiv - Cancer Biology 2024Quote: ... Target cells were transduced once with lentiviruses supplemented with 8 μg/mL polybrene (#TR-1003-G, Sigma-Aldrich) and selected with puromycin (2 μg/mL ...
-
bioRxiv - Cancer Biology 2024Quote: ... target cells were incubated overnight with lentivirus-containing medium with 8 µg/ml polybrene (Sigma, TR-1003-G). After 48 hours ...
-
bioRxiv - Neuroscience 2024Quote: Progesterone stock solution (800 µg/mL) was prepared by dissolving 8 mg of progesterone (Sigma, Catalog No. P0130) in 1 mL ethanol followed by 1:10 dilution in sesame oil ...
-
bioRxiv - Bioengineering 2024Quote: ... Mw 24,000-38,000Da); and poly(vinyl alcohol) (PVA; Mowiol 8-88; Mw ∼67,000Da) were both purchased from Sigma-Aldrich. Normal rat serum and pooled CSF collected from Sprague-Dawley rats were obtained from Invitrogen and BioIVT (USA) ...
-
bioRxiv - Microbiology 2024Quote: ... the animal’s drinking water was replaced from days 3-8 with water containing 5% L-arabinose (Sigma Aldrich). InducTn-seq samples were collected 8 days post inoculation by plating fresh feces on solid LB containing 50 µg/ml kanamycin ...
-
bioRxiv - Cell Biology 2024Quote: ... mice aged 8-12 weeks old mice were given 4 doses of 160 mg/kg tamoxifen (Sigma, T5649) dissolved in corn oil (Sigma ...
-
bioRxiv - Microbiology 2024Quote: ... cells were pelleted and resuspended in 250 μL lentivirus and 8 μg/mL DEAE-Dextran (Cat# D9885, Sigma) in a total volume of 1.7 mL ...
-
bioRxiv - Biophysics 2024Quote: ... 90,000 U2OS cells/well were seeded in 6-well with 8 ug/ml polybrene (Millipore #TR-1003-G) addition to the growth medium and infected with 4ul of lentiviral particle containing supernatant ...
-
bioRxiv - Immunology 2020Quote: ... were cultured at a concentration of 1 million cells per ml in complete media on pre-incubated anti-CD3/anti-CD28 bound plates in IL-2 (20ng/ml) (Sigma-Aldrich) for 2 days and then just IL-2 (20ng/ml ...
-
bioRxiv - Physiology 2019Quote: The interactions between TRPA1 and IL-R1 in nodose ganglia cultures were detected by PLA with Duolink in situ kit (Sigma- Aldrich). Primary nodose ganglion cells were harvested and cultured on glass coverslips as described above ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 x 105 IL-7 dependent primary Irf4−/− preB-I cell cultures were resuspended in 400 µL RPMI medium (D5030, Sigma-Aldrich) with 600 µL viral supernatant and 1.5 µL polybrene and spun in culture plates at 2700 RPM for 90 min at 37 °C ...
-
bioRxiv - Neuroscience 2020Quote: Fluorescent immunostaining for nuclear NFκB and cytoplasmic NFκB was quantified in immortalized C8D30 astrocytes following 2-hr treatment with 1μg/ml LPS or a cocktail of 3 cytokines: Il-1α (3ng/ml, Sigma, Cat# I3901), TNFα (30ng/ml ...
-
bioRxiv - Neuroscience 2021Quote: ... the reporter cells were exposed to drugs or DMSO vehicle for one hour before the addition of 3 ng/mL IL-1a (Sigma, I3901), 400 ng/mL C1q (MyBioSource ...
-
bioRxiv - Immunology 2020Quote: ... extracellular Cn were removed by washing 2X with PBS and the macrophages were cultured for a further 24 h in fresh growth media containing either IFNγ to maintain the M1 polarization state or 100 ng/mL recombinant interleukin-4 (IL-4; Sigma-Aldrich, St ...
-
bioRxiv - Immunology 2022Quote: ... PBMCs cultures not supplemented with IL-2 overnight were stimulated with 25 ng/ml phorbol 12-myristate-13-acetate (PMA) (Sigma-Aldrich) and 1 μg/ml ionomycin (Sigma-Aldrich) ...
-
bioRxiv - Genetics 2019Quote: ... LP cells were incubated for 5 h with 20 ng/ml PMA and 1 μg/ml ionomycin in the presence of 10 μg/ml Berfeldin A (Sigma, IL). For FACS analysis ...
-
bioRxiv - Cell Biology 2019Quote: Genomic DNA was isolated from the si-NC and si-Dnmt3aos-transfected M(IL-4) macrophage cells and was then treated with bisulfite using the Imprint DNA Modification Kit (Sigma-Aldrich). Bisulfite sequencing and pyrosequencing were conducted by Shanghai Sangon Biotech Corporation ...
-
bioRxiv - Microbiology 2021Quote: ... All SEC-FPLC described in this study was performed on a GE Healthcare AKTA PV-908 FPLC system (Chicago, IL) on Superdex S200 10/300 GL (Sigma-Aldrich) and Superose 6 10/300 GL (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... and subsequently transduced twice with viral supernatant within 48 hrs in the presence of 50 IU/mL IL-2 and 6 mg/mL polybrene (Sigma-Aldrich). TCR-transduced T cells were expanded by stimulation with anti-CD3/CD28 Dynabeads (500,000 beads/106 cells ...
-
bioRxiv - Bioengineering 2021Quote: A1 reactive astrocytes were generated by culturing the purified astrocytes on PDMS coated tissue culture plates and then treating for 24 h with IL-1α (3 ng/ml, Sigma, I3901), TNF-α (30 ng/ml ...
-
bioRxiv - Immunology 2020Quote: ... the wells were washed with PBS-T and 3,3’,5,5’-tetramethylbenzidine peroxidase substrate (TMB, T0440-IL, Sigma, St Louis, MO, USA) added to the wells ...
-
bioRxiv - Immunology 2022Quote: ... All cocultures were maintained in SCGM supplemented with IL-2 (120 IU/ml) and in the presence of 10 µM raltegravir (Sigma-Aldrich) and 0.4 µM nevirapine (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... PBMCs were activated with interleukin-2 (IL-2) 450 UI/mL (Proleukin, Novartis pharma) and polybrene 2 µg/mL (Sigma-Aldrich) during at least 2 h before infection.
-
bioRxiv - Neuroscience 2024Quote: The viral particle stock was diluted in sterile saline (0.9% NaCl) (Hospira, Lake Forest, IL) with 0.01% Fast Green (Sigma, St. Louis, MI). A 10-µl Hamilton syringe (Hamilton Company ...
-
bioRxiv - Cell Biology 2020Quote: A2780 human ovarian cancer cells were maintained in RPMI-1640 medium (Sigma-Aldrich) supplemented with 10% (v/v ...
-
bioRxiv - Developmental Biology 2021Quote: ... mouse anti-human α-smooth muscle actin (Cy3 conjugated, cat. #C6198, Sigma Aldrich, 1:500 ...