Labshake search
Citations for Millipore Sigma :
2451 - 2500 of 10000+ citations for 6 Hydroxy 2 4 5 triaminopyrimidine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2020Quote: ... 5 mM glucose and 2% BSA for two hours while treated with 1 μM isoproterenol (Sigma-Aldrich), 10 μM forskolin with 0.5 mM IBMX (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2021Quote: ... The minimal medium was supplemented with 5 mM 2-(N-morpholino) ethanesulfonic acid (Mes: Sigma Chemical Co.) adjusted to pH 6.4 with NaOH as buffer and 0.5% (w/v ...
-
bioRxiv - Microbiology 2021Quote: 20 μg of fraction 19 were reduced with 5 mM Tris(2-carboxyethyl)phosphine (646547, Sigma Aldrich) for 60 min at 65 °C ...
-
Observation of an α-synuclein liquid droplet state and its maturation into Lewy body-like assembliesbioRxiv - Molecular Biology 2020Quote: ... larvae were placed on nematode growth medium (NGM) plates containing 5-fluoro-2’deoxy-uridine (FUDR, Sigma) (75 μM ...
-
bioRxiv - Microbiology 2020Quote: ... Continuous culture was typically carried at 2-5%-hematocrit in RPMI-1640 (Sigma Aldrich, Cat. No. R6504) supplemented with HEPES ...
-
bioRxiv - Immunology 2022Quote: Total RNA was collected from cultured cells treated with 100 nM 5-aza-2⍰-deoxycytidine (decitabine; Sigma) or splenocytes from a naïve C57BL/6 mouse using NucleoSpin RNA Plus (Takara) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Samples were combined with NuPage LDS sample buffer 4x (#2083421) and 5% 2-Mercaptoethanol (Sigma Aldrich #M6250) and heated for 10 minutes at 70°C ...
-
bioRxiv - Synthetic Biology 2019Quote: Replica-plated cell populations were treated with varying concentrations of 5-aza-2’-deoxycytidine (Sigma-Aldrich, A3656) or Trichostatin A (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2019Quote: ... GluR inhibition was performed using 40 µM D(-)-2-amino-5-phosphonopentanoic acid (APV, #A8054, Sigma Aldrich) and 2 µM 6,7-dinitroquinoxaline-2,3-dione (DNQX ...
-
bioRxiv - Neuroscience 2021Quote: ... A CRISPR-Cas9 crRNA (5’- GAGGCCAAGATGAGTACTGAGG-3’) targeting exon 2 of Blvra was synthesized by Sigma Aldrich. A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... before fixation for 5 hrs in humid conditions at 37 °C in 1.4% / 2% formaldehyde (F8775 Sigma) / acrylamide (A4058 Sigma) ...
-
bioRxiv - Cancer Biology 2021Quote: Polyacrylamide (PA) gels of varying stiffness (0.5, 2, and 5 kPa) were fabricated on 3-APTMS (Sigma) functionalized glass coverslips by combining 40% acrylamide and 2% bis-acrylamide in specific ratios as described previously [81] ...
-
bioRxiv - Neuroscience 2020Quote: All birds received intramuscular injections of 5-Bromo-2’-deoxyuridine (BrdU; 74 μg/g, pH 7.4, Sigma) 3x/day for three days to label mitotically active cells ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were then blocked for 2☐h in 5% bovine serum albumin (BSA, Sigma-Aldrich, A7906) in 0.01☐M PBS and 0.3% Triton X-100 (Sigma-Aldrich ...
-
bioRxiv - Genomics 2020Quote: ... the cells were spun down and moved to “Phase 2” IMDM media containing 5% human serum (Sigma), 330µg/mL transferrin ...
-
bioRxiv - Cancer Biology 2022Quote: ... S-phase populations were identified by incorporation of 10 μM 5-ethynyl-2’-deoxyuridine (EdU; Sigma-Aldrich) 45 min before fixation ...
-
bioRxiv - Cell Biology 2022Quote: ... A small piece of frozen BAT (2 – 5 mg) was transferred into a BeadBug tube (Sigma Aldrich) containing 1.0 mm zirconium beads (Merck ...
-
bioRxiv - Developmental Biology 2022Quote: Time-pregnant mice were injected with 5-bromo-2’deoxyuridine (BrdU) (50 mg/kg body weight, Sigma) 1 h before the harvest of embryos ...
-
bioRxiv - Neuroscience 2023Quote: Mice were injected intraperitoneally (i.p.) once with 150 mg/kg of 5-bromo-2′-deoxyuridine (BrdU; Sigma) 24 hours before sacrifice for cell proliferation assessment ...
-
bioRxiv - Physiology 2022Quote: ... they were picked onto NGM treatment plates containing 49.5 μM 5-fluoro-2’-deoxyuridine (FUDR, Sigma F0503) to prevent progeny production and either α-KB or vehicle (water ...
-
bioRxiv - Physiology 2024Quote: ... The NC membrane was initially blocked with 5% nonfat milk and 2% BSA (A4503, Sigma (v/v)) in tris buffered saline with 0.1% Tween 20 (93773 ...
-
bioRxiv - Microbiology 2024Quote: ... and Tuba (5’-CAGAATCATGATGAGGCCAtt-3’. These siRNAs were obtained from Sigma-Aldrich (Dyn2-2 and Dyn2-3) or Qiagen (Tuba ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were labeled with 25 µM 5-Chloro-2’-deoxyuridine (CldU, Sigma-Aldrich, CAS 50-90-8) for 30 min ...
-
bioRxiv - Neuroscience 2024Quote: ... a total of 2 intraperitoneal injections of calcein (5 mg/kg; Sigma-Aldrich, St. Louis, MO, USA) were given at 7-day intervals at the end of CUMS modeling ...
-
bioRxiv - Developmental Biology 2024Quote: ... followed by a second 20-minute pulse with 250 µM 5-chloro-2-deoxyuridine (C6891, Sigma-Aldrich). The labeled cells were then washed twice with ice-cold 1X PBS ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were sequentially pulse-labeled with 50 μM of 5-chloro-2′-deoxyuridine thymidine (CldU) (Sigma-Aldrich) and 250 μM of idoxuridine (IdU ...
-
bioRxiv - Physiology 2023Quote: ... The NC membrane was initially blocked with 5% nonfat milk and 2% BSA (A4503, Sigma (v/v)) in Tris buffered saline with 0.1% Tween 20 (93773 ...
-
bioRxiv - Physiology 2023Quote: ... The NC membrane was initially blocked with 5% nonfat milk and 2% BSA (A4503, Sigma (v/v)) in tris buffered saline with 0.1% Tween 20 (93773 ...
-
Activation of glucocorticoid receptor signaling inhibits KSHV-induced inflammation and tumorigenesisbioRxiv - Cancer Biology 2023Quote: ... Cell cycle was examined by flow cytometry following 5′-bromo-2′-deoxyuridine (BrdU) labeling (BrdU: Sigma-Aldrich, MB5002 ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.5 μl of 30 mM D-(-)-2-Amino-5-Phosphonopentanoic acid (D-APV, Sigma Aldrich, Cat #: A8054) dissolved in ACSF (Wang ...
-
bioRxiv - Neuroscience 2023Quote: ... short term neighbor rescue experiment NSCs were incubated with 20 µM 5-bromo-2’-deoxyuridine (BrdU) (Sigma) for 2 hours then fixed with 4% paraformaldehyde prior to immunohistochemical processing ...
-
bioRxiv - Cell Biology 2023Quote: ... The dermis was injected with approximately 2-5 μl TAT-Cre recombinase (200 U/ml; Sigma-Aldrich) using a glass microcapillary pipette ...
-
bioRxiv - Genomics 2023Quote: ... about 107 exponentially growing cells were pulse-labelled with 5-Bromo-2’-deoxyuridine (BrdU, Sigma-Aldrich #B9285) for 1 h and sorted into four S-phase fractions ...
-
bioRxiv - Cell Biology 2023Quote: ... total proteins were loaded in the Laemmli sample buffer supplemented with 5% 2-mercaptoethanol (Sigma, catalog #: M3148) to reduce the disulfide bonds ...
-
bioRxiv - Bioengineering 2023Quote: ... polyethylene oxide polymers (Mw: 1 MDa, Mw: 2 MDa, and Mw: 5 MDa, Sigma-Aldrich, Buchs, Switzerland) were fully dissolved in PBS to a concentration of 1% (w/v) ...
-
bioRxiv - Neuroscience 2023Quote: ... 3-dione (CNQX) and 50 mM D,L-2-amino-5-phosphonovaleric acid (APV) acquired from Sigma to suppress post-synaptic responses ...
-
bioRxiv - Genetics 2023Quote: ... Cells are then blocked with 2 mL blocking solution made of 5% BSA (cat#A3059-10G Sigma) and 0.05% Triton X-100 in PBS for 2 hours at RT or 4°C on a shaker.
-
bioRxiv - Cell Biology 2023Quote: ... cells were incubated for 24 h in medium containing 2 mM thymidine (Sigma-Aldrich, 50-89-5), followed by release in fresh medium ...
-
bioRxiv - Biochemistry 2023Quote: ... then 250 µL of neurobasal supplemented with 40 µM of 5-fluoro-2’-deoxyuridine (FUDR, Sigma F0503) and NGF was carefully added to the well ...
-
bioRxiv - Developmental Biology 2024Quote: ... cells were labeled with 20 mM 5-chloro-2-deoxyuridine (CldU, Sigma-Aldrich by Merck, Darmstadt, Germany) for 20 min ...
-
bioRxiv - Neuroscience 2024Quote: ... larvae were immediately placed in a solution of 50 µm 5-ethynyl-2’-deoxyuridine (EdU; Sigma-Aldrich) and were allowed to develop in this solution.
-
bioRxiv - Molecular Biology 2024Quote: ... 200 µg of protein was reduced with 5 mM Tris(2-carboxyethyl) phosphine hydrochloride (TCEP) (Sigma Aldrich) for 2 min and alkylated with 20 mM chloroacetamide (CAA ...
-
bioRxiv - Physiology 2021Quote: ... The neurotoxin (6-hydroxydopamine) was purchased from Sigma-Aldrich (6-OHDA, H4381, St. Louis, MO).
-
bioRxiv - Zoology 2019Quote: ... and pterin-6-carboxylic acid (pterin-6-COOH) were purchased from Sigma Aldrich (Munich, Germany). Isoxanthopterin and xanthopterin were obtained from Fluka (Buchs ...
-
bioRxiv - Genomics 2021Quote: ... Antigen retrieval was done by microwaving for 6 minutes in citrate buffer pH 6 (Sigma). After quenching in 3% H2O2 in Methanol ...
-
bioRxiv - Neuroscience 2023Quote: ... the cells were treated with 6-hydroxydopamine hydrochloride (6-OHDA, 15 µM, H4381, Sigma Aldrich) and METTL3/14 activators (100 nM or 1 µM) ...
-
bioRxiv - Neuroscience 2024Quote: ... and a solution of 10 mg/mL 6-hydroxydopamine (6-OHDA; Sigma-Aldrich, H116-5MG), dissolved in saline buffer was injected ...
-
bioRxiv - Cancer Biology 2021Quote: 4-hydroxytamoxifen (4-OHT, Sigma, #7904) was dissolved in 100% ethanol (1 mM stock solution) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4-hydroxytamoxifen (4-HT [Sigma, H7904]) was dissolved in methanol to a concentration of 5 mg/ml ...
-
bioRxiv - Developmental Biology 2020Quote: ... or 4-Hydroxytamoxifen (4-OH, Sigma) was dissolved to a final concentration of 1mg/ml or 3mg/ml in 90% corn oil (Sigma ...