Labshake search
Citations for Millipore Sigma :
2351 - 2400 of 2589 citations for Rat FAM24A shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... residues 353-598) and human RXRα (NR2B1) LBD (residues 223-462) that were inserted into a pET45b(+) plasmid (Novagen) as a TEV-cleavable N-terminal hexahistidine(6xHis)-tag fusion protein ...
-
bioRxiv - Cell Biology 2023Quote: ... The cDNA of this segment was synthesized by Invitrogen and cloned into plasmid pMA-RQ and further subcloned into the bacterial expression vector pET-14b (Novagen/EMD Millipore). The protein was expressed in Bl21 bacteria with the addition of IPTG to a final concentration of 1 mM ...
-
bioRxiv - Cell Biology 2023Quote: ... The cDNA of this segment was synthesized by Invitrogen and cloned into plasmid pMA-RQ and further subcloned into the bacterial expression vector pET-14b (Novagen/EMD Millipore). The protein was expressed in Bl21 bacteria with the addition of IPTG to a final concentration of 1 mM ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were transfected with 45 ng of plasmid DNA/well using polyethylenimine (PEI) (Sigma-Aldrich, St. Louis, MO, USA) at a 4:1 ratio PEI:DNA in complete media ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were transfected with 700 ng of plasmid DNA/well using polyethylenimine (PEI) (Sigma-Aldrich, St. Louis, MO, US) at a 4:1 ratio PEI:DNA in Opti-MEM (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... that were cultured and prepared using a GenElute HP Plasmid Midi kit (NA0200-1KT, Sigma-Aldrich, St. Louis, MO).
-
bioRxiv - Genomics 2023Quote: ... The 800 µl of the plasmid mixture was mixed with 800 µl of HEPES buffered saline (Sigma, 51558-50ML) by making bubbles slowly in a dropwise manner ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were manually scraped off plates to perform a plasmid DNA purification using GenElute Megaprep kit (NA0600-1KT, Sigma).
-
bioRxiv - Cancer Biology 2023Quote: ... The plasmids were incubated in 200 μl Opti-MEN medium mixed with X-tremeGENE HP DNA Transfection Reagent (Sigma) (ratio of reagent ...
-
bioRxiv - Biochemistry 2023Quote: ... were transformed with the pET28 plasmid and induced with 0.5 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) (Millipore Sigma) when the optical density at 600 nm reached 0.6 ...
-
bioRxiv - Neuroscience 2023Quote: ... Embryos were injected in lateral ventricle with ∼1 μl of DNA plasmid solution (diluted in endotoxin-free water and 0.002% Fast Green FCF (Sigma)) ...
-
bioRxiv - Biochemistry 2023Quote: 293T cells were seeded into 6-well plates and transfected with replicon plasmid using Xtreme-Gene9 transfection reagent (Sigma). 24 hours post-transfection ...
-
bioRxiv - Developmental Biology 2024Quote: ... pCAG-PiggyBac transposase or PB-pCAG-H2B-GFP (final concentration: 1-2 μg/μL) plasmid was mixed with 0.05% Fast Green (Sigma) and injected into the lateral ventricle of embryos (0.5 μL per embryo ...
-
bioRxiv - Cell Biology 2024Quote: ... and 1 μg viral plasmid were diluted in 6 μL X-tremeGENE 9 DNA transfection reagent (Sigma-Aldrich, 6365787001) and 150 μL DMEM and incubated at room temperature for 15 min before being added to the cells ...
-
bioRxiv - Biochemistry 2024Quote: ... Bacteria containing the corresponding plasmids were grown in LB broth supplemented with 75 µg ml-1 Amp (Sigma-Aldrich) under agitation at 37°C for 24 h ...
-
bioRxiv - Biophysics 2020Quote: ... the following target sequences were used: 5’-GCTTCAGGATTCAATGCCATGG-’3 (#1) using the all-in-one CRISPR/Cas9 plasmid (Sigma-Aldrich) followed by cell-sorting for GFP expression to generate single cell clones with disrupted ANXA4 reading frame.
-
bioRxiv - Developmental Biology 2021Quote: ... Zebrafish lines expressing transgenic Spaca6 were generated by injecting the spaca6 expression construct with Tol2 mRNA into spaca6+/− zebrafish embryos (15 ng/μl of the plasmid in RNase-free water, 35 ng/μl Tol2 mRNA, 0.083% phenol red solution [Sigma-Aldrich]), following standard procedures ...
-
bioRxiv - Cell Biology 2020Quote: HeLa cells were co-transfected with each Rubicon plasmid and mRFP-Rab79 and stained with anti-FLAG M2 antibody (Sigma) at 48h post-transfection.
-
bioRxiv - Cell Biology 2020Quote: For purification of full-length Sar1, we used a previously reported plasmid (McMahon et al., 2012) using the pET21b (Novagen) backbone that expresses full-length Sar1 from Saccharomyces cerevisiae with a C-terminal hexahistidine tag ...
-
Bidirectional neuronal migration coordinates retinal morphogenesis by preventing spatial competitionbioRxiv - Developmental Biology 2021Quote: ... one-cell-stage embryos were injected with purified plasmid DNA diluted in ddH2O supplemented with 0.05% phenol red (Sigma-Aldrich). Concentrations of individual constructs ranged from 10 to 25 ng/μL ...
-
bioRxiv - Microbiology 2021Quote: ... encoding PPK with a C-terminal GAAEPEA peptide tag for affinity purification (105) between the NdeI and HindIII sites of plasmid pET-21b(+)(Novagen), was synthesized by GenScript.
-
bioRxiv - Cell Biology 2022Quote: RAW-ASC and iBMDM cells were transfected with custom CRISPR gRNA plasmid DNA (U6-gRNA:CMV-Cas-9-2A-tGFP) (Sigma-Aldrich) using FuGENE HD transfection reagent (Promega) ...
-
bioRxiv - Biochemistry 2022Quote: ... were transformed with the plasmid and plated onto Luria broth (LB) agar supplemented with 50 μg mL−1 kanamycin (Sigma) and grown overnight at 37 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... The reaction was stopped by the addition of 500 ng of plasmid (size > 10 kb) and 0.1 pmol of ATP-γ-S tetralithium salt (10102342001-Roche, Sigma) followed by incubation for 30 min at 30°C ...
-
DNA writing at a single genomic site enables lineage tracing and analog recording in mammalian cellsbioRxiv - Synthetic Biology 2019Quote: ... All plasmids to be used for transfection were purified with HP GenElute Midi or Mini kits (Sigma # NA0200 and NA0150).
-
bioRxiv - Immunology 2019Quote: MCA205 and B16F10 mouse cell lines are transfected with the plasmid YFP-Globin-SL8-intron or with the PCDNA3 empty plasmid (negative control) with the transfection reagent jetPRIME (Ozyme) or GeneJuice (Millipore) respectively according to each manufacturer protocol ...
-
bioRxiv - Biochemistry 2019Quote: ... Xa factor site and StreptagII sequence in its N-terminus are digested by HindIII and BamHI and then inserted into a pET-20b plasmid (Novagen). The over-expression in BL21 (DE3 ...
-
bioRxiv - Biochemistry 2019Quote: ... Xa cleavage site and StrepTagII sequence in its N-terminus part were digested with XbaI and Hind III enzymes and inserted into pET-20b plasmid (Novagen). The over-expression in Rosetta (DE3 ...
-
bioRxiv - Microbiology 2019Quote: ... These plasmids were transfected into Rossetta 2 cells and this system was used for expression according to manufacturer’s instructions (EMD Millipore) for expression ...
-
bioRxiv - Cancer Biology 2019Quote: ... Desired constructs were amplified from the complete RNF114 sequence with primers that contained 20 base pairs of homology to a pET24a plasmid (Novagen) that had been modified to contain a His8-MBP-TEV sequence between the Nde1 and BamH1 restriction sites ...
-
bioRxiv - Developmental Biology 2020Quote: ... The cDNA sequence corresponding to sim-PD (aa 361-672) was PCR amplified and cloned in-frame with a 6xHis-Tag into a modified pET-14b plasmid (Novagen). The expression plasmid was transformed into BL21 competent E ...
-
bioRxiv - Biochemistry 2020Quote: QnrB1/DNA binding competition assays were performed as follows: 90 bp Cy5-labelled oligonucleotide encompassing the strong gyrase binding site from plasmid pBR322 was ordered from Sigma and annealed with an antisense unlabelled oligo by heating to 99°C and gradual cooling ...
-
bioRxiv - Genetics 2021Quote: ... All plasmids to be used for transfection were purified with HP GenElute Midi or Mini kits (Sigma # NA0200 and NA0150).
-
bioRxiv - Cell Biology 2021Quote: ... SF9 cells at 1×106 cells/ml were co-transfected by the linearised Defbac viral backbone and the plasmids encoding for exocyst subunits or PIP5K1C using ESCORT-IV (Sigma). After 5 days ...
-
bioRxiv - Cell Biology 2020Quote: ... the α-PheRS or α-PheRSCys mutant cDNAs were cloned with His tags at the N-terminal end into the pET-28a plasmid expression vector (Novagen). Wild-type β-PheRS cDNAs were cloned into the pET LIC (2A-T ...
-
bioRxiv - Biophysics 2021Quote: ... The spectinomycin resistance gene on the pULTRA-CNF plasmid was replaced by the kanamycin resistance gene from pRSF1b (EMD Millipore) for use in TOP10 cells.
-
Mediobasal hypothalamic FKBP51 acts as a molecular switch linking autophagy to whole-body metabolismbioRxiv - Neuroscience 2021Quote: ... A total of 2.5 μg of plasmid DNA or 80 ng of siRNA (siWIPI3, EMU081491 or siWIPI4, EMU007321 or siControl, SIC001 all Sigma) was used per transfection ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were transfected with 1 μg of nucleocytoplasmic transport reporter (NLS-tdTomato-NES) plasmid (received as a gift from Dr. Martin W. Hetzer, Salk Institute) using Novagen Nanojuice Transfection Reagent (Millipore-Sigma). 4 h after transfection ...
-
bioRxiv - Biophysics 2020Quote: ... was PCR amplified from previously described pCDFDuet-1-RUVBL2 plasmid (Lopez-Perrote et al., 2012) and inserted into pET21b vector (Novagen) using the IVA cloning system (Garcia-Nafria et al. ...
-
bioRxiv - Biophysics 2020Quote: ... 293T cells were transfected with 2.5 μg of ΔEnv IN-HIV-1 plasmid (DHIV3-GFP-D116G)11 using 10 μg of polyethylenimine (PEI, branched, MW ∼25,000, Sigma-Aldrich). After 20 h ...
-
bioRxiv - Immunology 2021Quote: PCR was used to amplify EtMIC3 DNA from the pET22b MIC3 plasmid using primers (F: GCTATCGGATCCCAAGCCGTTCCAGAGG, R: CTGCGAGAATTCGCCACTTGGATCTTCCGTT, 0.4 μM final concentration, Sigma Aldrich) that incorporated appropriate restriction enzyme sites (Bam HI and Eco RI ...
-
bioRxiv - Microbiology 2021Quote: ... 105 MA104 cells were transfected with the pCMV-HyPBase (63) and transposon plasmids pPB-cytBirA using a ratio of 1:2.5 with Lipofectamine 3000 (Sigma-Aldrich) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... PCR-positive colonies were grown and the vector was extracted using GenElute Plasmid Miniprep Kit following manufacturer’s protocol (Sigma-Aldrich). The vector was then transformed into expression strain E ...
-
bioRxiv - Biophysics 2021Quote: ... 293T cells were transfected with 2.5 μg of ΔEnv IN- HIV-1 plasmid (DHIV3-GFP-D116G) (31) using 10 μg of polyethylenimine (PEI, branched, MW ~25,000, Sigma-Aldrich). After 20 h ...
-
bioRxiv - Biophysics 2020Quote: ... Cell cultures were transfected with 1mg of plasmid per liter of culture at a density of 2×106/ml using polyethylenimine (Sigma). The supernatants were collected 72 hours later ...
-
bioRxiv - Biophysics 2020Quote: ... The plasmids were transiently transfected to the TMEM16F-KO HEK 293T cells by using X-tremeGENE9 transfection reagent (Millipore-Sigma). Cells grown on poly-L-lysine (PLL ...
-
bioRxiv - Cell Biology 2020Quote: ... mADD1 has 6xHis tag at its N terminus followed by TEV protease recognition site and the plasmid was transformed into Rosetta (DE3) pLysS cells (Novagen). Target protein was expressed in cultures grown in autoinduction media at 18°C overnight 48 ...
-
bioRxiv - Immunology 2022Quote: ... and 11.05 μg of each pCVL-derived gH plasmid were mixed in 1.56mL PBS followed by 39µL of Freestyle Transfection Reagent (Millipore, catalog #72181). The transfection mix was gently agitated ...
-
bioRxiv - Biochemistry 2022Quote: ... codon-optimized for Escherichia coli (E. coli) was cloned into the first multiple cloning site (MCS) of the pRSFDuet plasmid (Novagen), with N-terminal hexahistidine purification (His6 ...
-
bioRxiv - Microbiology 2020Quote: ... The construction of baculovirus transfer vectors encoding hVP3 mutant polypeptides were generated using PCR-based site directed mutagenesis on the pFB/hisVP3 plasmid (Kochan et al. 2003) using synthetic DNA oligonucleotide primers (Sigma) described in Supplementary Table 1 ...