Labshake search
Citations for Millipore Sigma :
2201 - 2250 of 2589 citations for Rat FAM24A shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... pIEX-10:Neo plasmid carries the neomycin resistance cassette and provides resistance to the antibiotic G418 (Sigma) which allows for selection of transfected cells ...
-
bioRxiv - Cell Biology 2019Quote: ... All constructs were prepared for transfection using the GenElute HP Endotoxin-Free Plasmid Maxiprep Kit (Sigma-Aldrich).
-
bioRxiv - Immunology 2020Quote: ... Plasmids were transiently transfected into 293F suspension cells as previously described using polyethyleneimine transfection reagent (Sigma-Aldrich) [25] ...
-
bioRxiv - Cell Biology 2020Quote: ... Plasmids were transfected into U2OS and 293T cells using X-tremeGENE™ 9 DNA Transfection Reagent (Sigma) or HBMEC cells using Lipofectamine 3000 (ThermoFisher ...
-
bioRxiv - Biochemistry 2021Quote: ... 100ng of a plasmid coding for a gene of interest was transfected using PEI transfection reagent (Sigma). Supernatants were collected 24h post-transfection ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... plasmid coding for 6x-His-Cas9 were transformed in Rosetta DE3 Novagen competent cells (Merck Millipore, USA). Protein production was induced using autoinduction medium (Formedium ...
-
bioRxiv - Cell Biology 2020Quote: ... Purification of both protein constructs was similar: plasmid was transformed into the Rosetta2 strain of E.coli (Novagen). Two liters of culture were grown in terrific broth for 8-12h at 37°C (until the OD600 ~2) ...
-
bioRxiv - Microbiology 2021Quote: ... of human DDX21 isoform 1 (NM_004728.4) and isoform 2 (NM_001256910.1) into plasmid p3XFLAG-CMV-14 (Sigma-Aldrich), respectively ...
-
bioRxiv - Molecular Biology 2020Quote: ... An open-reading frame of the truncated Pch2 was PCR-amplified and inserted into pET15b plasmid (Novagen) in which an N-terminus of the PCH2 gene was tagged with hexa-histidine ...
-
bioRxiv - Cell Biology 2022Quote: Cells expressing URA3 plasmids were grown overnight in 1× YNB medium (Sigma Aldrich, St. Louis, MO, USA), containing 1% Ethanol (Boom BV ...
-
bioRxiv - Biochemistry 2022Quote: ... and H3 (residues 38-135) in a pDEST plasmid were expressed in BL21 Rosetta2 (DE3) cells (Novagen) and purified from inclusion bodies as previously described except for minor modifications for the purification of tailless histones(14 ...
-
bioRxiv - Cancer Biology 2024Quote: ... For P30 EPO the plasmid mixture was adjusted to 1:100 with methylene blue dye (Sigma 50484) in PBS in a final volume of 25µl per leg ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified plasmid constructs were used to transform the bacterial expression strain Rosetta™(DE3)pLysS (EMD Millipore). To express protein ...
-
bioRxiv - Neuroscience 2024Quote: A mix of endotoxin-free plasmid preparation (2 mg/mL total concentration) and 0.5% Fast Green (Sigma) was injected into one lateral hemisphere of E15.5 embryos using a Picospritzer III (Parker) ...
-
bioRxiv - Biochemistry 2024Quote: ... and 0.57 µg VSV-G plasmid (pMD2.G) using 26 µL of XtremeGene HP (6366244001, Sigma Millipore) in 1 mL of Optimem (11058-021 ...
-
bioRxiv - Biochemistry 2024Quote: ... and 0.57 µg VSV-G plasmid (pMD2.G) using 26 µL of XtremeGene HP (6366244001, Sigma Millipore) in 1 mL of Optimem (11058-021 ...
-
bioRxiv - Biochemistry 2023Quote: ... Both plasmids (ATAD2/B) were transformed into Escherichia coli BL21(DE3) pLysS competent cells (Novagen, MA, USA) for protein expression.
-
bioRxiv - Neuroscience 2023Quote: ... Embryos were exposed and injected with∼1.5 μl of mixed plasmid DNA with Fast Green (Sigma Aldrich) into the lateral ventricle via a beveled micropipette ...
-
bioRxiv - Bioengineering 2023Quote: ... The product plasmids were then transformed into Rosetta™(DE3)pLysS Competent Cells (Millipore Sigma, Catalog #70956) following the manufacturer’s protocols.
-
bioRxiv - Cancer Biology 2023Quote: ... and renilla plasmid transfection was performed using the GeneJuice transfection reagent following the manufacturer’s instructions (Sigma, 70967). For stable expression of TMEM192-3xHA and TMEM192-2xFLAG ...
-
bioRxiv - Biochemistry 2022Quote: The NKX2-5 homeodomain gene (DNASU Plasmid Repository) was cloned in a pET-51(+) expression vector (Novagen) containing an N-terminal Strep•Tag® and a C-terminal 10X His•Tag® through Gibson Cloning and used to transform BL21 DE3 E ...
-
bioRxiv - Cell Biology 2023Quote: Lentivirus containing a plasmid programmed to express either CMIP-specific sgRNA (ACGTCTTCAATGGCGCTGTAGG, Millipore Sigma, Sanger Clone MM5000005403) or non-targeting control sgRNA (Millipore Sigma ...
-
bioRxiv - Genetics 2023Quote: ... 250–500 ng of labeled plasmid and 12.5–25 μg of sonicated salmon sperm DNA (Sigma-Aldrich) were used per slide ...
-
bioRxiv - Genetics 2023Quote: ... 250–500 ng of labeled plasmid and 12.5–25 μg of sonicated salmon sperm DNA (Sigma-Aldrich) were applied per slide ...
-
bioRxiv - Microbiology 2023Quote: ... parasites containing the episomal plasmids selected with WR99210 were grown with 400 μg/ml Neomycin/G418 (Sigma) to select for transgenic parasites carrying the desired genomic modification as described previously (Birnbaum et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cell lines were transduced with Luc-plasmid using Sigma® MISSION® ExpressMag® Beads (Sigma-Aldrich) and selected under hygromycin antibiotic (Sigma-Aldrich) ...
-
bioRxiv - Biophysics 2023Quote: ... The plasmids were transiently transfected to TMEM16F-KO HEK293T cells using X-tremeGENE9 transfection reagent (Sigma-Aldrich). Cells grew on coverslips coated with poly-L-lysine (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2023Quote: ... coli RIL strains carrying the appropriate plasmid were grown in 1 l Luria-broth (LB) (Merck Millipore) supplemented with kanamycin (100 μg/ml ...
-
bioRxiv - Neuroscience 2023Quote: The pET-28a plasmid expressing the GluK2-LBD construct was transformed into competent OrigamiTM 2 cells (Novagen). Cells were plated out on a Lysogeny Broth (LB ...
-
bioRxiv - Cell Biology 2023Quote: The Cno DIL domain sequence (aa 613-1006) was cloned into plasmid pET28 (Millipore Sigma, Burlington, MA) using PCR and primers with engineered NheI and EcoRI restriction sites ...
-
bioRxiv - Cancer Biology 2023Quote: Bacterial expression plasmids for rFGF19/rAldafermin were transformed into Rosetta-gami™ 2 (DE3) competent cells (Novagen). Bacteria were cultured in LB medium + 100μg/mL ampicillin and induced with 0.2mM IPTG at 30°C for 3h.
-
bioRxiv - Systems Biology 2023Quote: ... cells were transfected with 10µg of library-containing plasmid using X-tremeGENE 9 transfection reagent (Sigma-Aldrich) at a ratio of 3:1 reagent to DNA (30µL transfection reagent for 10µg plasmid ...
-
bioRxiv - Physiology 2024Quote: ... # 58376)27 together with the helper plasmid pDP828 in HEK-293T cells using polyethylenimine (Sigma-Aldrich, Darmstadt, Germany). AAV vectors were purified using iodixanol step gradients and titrated as described.29
-
bioRxiv - Cell Biology 2021Quote: ... Rats were fed a high fat and high carbohydrate diet (HFD) for one month after which streptozotocin (Sigma-Aldrich, St. Louis, MO, USA, 40 mg/kg) dissolved in 10 mmol/L citrate buffer (pH 4.5 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... urine samples were aliquoted into 96-well black plates supplied with MILLIPLEX® MAP Rat Kidney Toxicity Magnetic Beed Panel 1 (EMD Millipore Corporation, Charles, MO, USA), prepared and analyzed per manufacturer’s recommendations.
-
bioRxiv - Developmental Biology 2020Quote: ... and were then placed in embryo culture medium (50% DMEM/F-12 containing Glutamax and 50% Rat Serum) containing 10 μm of 4-OH-tamoxifen (Sigma H7904, dissolved at 10mM in DMSO) for 90 min ...
-
bioRxiv - Neuroscience 2023Quote: ... animals received the first of 6 injections of either vehicle (propylene glycol) or progesterone (>99% progesterone, purified from rats, Sigma-Aldrich Co. St. Louis, MO, USA) at a dose of 4 mg/kg (Shear et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... Secondary antibodies fused to HRP were used for detection (Goat anti-mouse HRP 1:3000, BioRad; Goat anti-rat HRP 1:3000, Merck Millipore; Goat anti-rabbit HRP 1:3000, BioRad)
-
bioRxiv - Bioengineering 2023Quote: ... The slides were then incubated in the primary antibodies (rat anti-PECAM-1, clone 390, EMD Millipore; rabbit anti-NG-2 chondroitin sulfate, EMD Millipore; rabbit anti-Keratin-14, BioLegend) diluted 1:100 in the blocking solution overnight at 4 °C ...
-
bioRxiv - Bioengineering 2022Quote: ... the product was digested with NcoI and NotI and ligated into the pET45b(+) expression plasmid (Novagen/EMD Millipore). Integration in the pET45b(+ ...
-
bioRxiv - Bioengineering 2022Quote: ... the product was digested with NcoI and NotI and ligated into the pET45b(+) expression plasmid (Novagen/EMD Millipore). Integration in the pET45b(+ ...
-
bioRxiv - Biophysics 2019Quote: ... For lipid mobility measurements inside and outside of Gag assembly sites in mammalian cells 3×105 Jurkat T cells 72 h post-infection with NL4.3 HIV-1 Gag-iGFP virus particles or 24 h post-transfection with NL4.3 HIV-1 Gag-eGFP expressing plasmid were resuspended in 200 µL of Leibovitz’s L 15 medium (Sigma) and incubated with 25 nM of the indicated fluorescent lipid analogue probe for 5 min at 37 °C ...
-
bioRxiv - Neuroscience 2020Quote: ... Approximately 700nl of either pUb6-tdTOM or pUb6-Sema3a-tdTOM plasmid (2µg/ml with 1% Fast Green, Sigma) was delivered into the lateral ventricle of embryo’s brain through a beveled glass pipette applied to a Picospritzer (Parker) ...
-
bioRxiv - Biochemistry 2021Quote: 100 bacterial homologs of nucleobase/cation symporter 2 (NCS2) proteins were cloned into a modified pET28 plasmid (Novagen) with either an N- or a C-terminal deca-histidine tag and a TEV protease recognition site at the central facility of the New York Consortium on Membrane Protein Structure (NYCOMPS ...
-
bioRxiv - Neuroscience 2021Quote: ... The plasmid was linearized and subjected to in vitro transcription with digoxigenin labeling (DIG RNA labeling kit, Sigma). Sections were hybridised with 500 ng/ml riboprobe in hybridization solution at 72°C overnight ...
-
bioRxiv - Biochemistry 2020Quote: ... Plasmid constructs were confirmed by DNA sequencing and transformed into Escherichia coli BL21 (DE3) Rosetta2™ (Novagen®). Bacterial cells were cultured at 37°C in Terrific Broth containing 50 μg/ml kanamycin in Ultra Yield™ baffled flasks (Generon ...
-
bioRxiv - Cell Biology 2021Quote: ... and/or with plasmid DNA (e.g. 1µg/well for 6-well plates) for 24 hrs using GeneJuice (Merck Millipore). siRNAs targeting USP7 ...
-
bioRxiv - Cell Biology 2021Quote: ... A plasmid encoding for TrxHis-Cobl-like1-411 was generated by PCR and subcloning into pET-32 (Novagen) (primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... This plasmid was transformed to Novagen’s Rosetta™ 2(DE3)pLysS competent cells (Millipore Sigma, Cat#71403-3) for rhFGF10 expression ...
-
bioRxiv - Cell Biology 2022Quote: ... plasmids encoding the final constructs were transformed into 20 μL of Rosetta (DE3) competent cells (EMD Millipore, 70954) and grown overnight at 37°C in 5mL LB containing 100 μg/mL Ampicillin (Fisher Scientific ...