Labshake search
Citations for Millipore Sigma :
2151 - 2200 of 2487 citations for 8 Bromoguanosine hydrate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... The supernatant was discarded and the resulting pellet was resuspended with wash buffer (20 mM Tris pH 8, 150 mM NH4Cl, 20 mM MgCl2 supplemented with 1X Cell Lytic B (Sigma-Aldrich). The sample was then spun at 4,000 x g at 4°C for 10 min followed by removing the supernatant and resuspension of the pellet in 4 mL of 50 mM Tris-HCl pH 8 ...
-
bioRxiv - Microbiology 2020Quote: ... The pellet was then resuspended in 330 μL Sorbitol buffer and 192 μL of this suspension were mixed with 8 μL of 50 mg/ml 100T Zymolase (2 mg/ml final concentration; Sigma-Aldrich) and incubated for 5 minutes at 30 °C ...
-
bioRxiv - Immunology 2021Quote: ... DCs (3 days post-bone marrow extraction) were transduced by adding lentiviral supernatants in the presence of DEAE dextran (8 µg/ml; Sigma-Aldrich) to cells for 4 h ...
-
bioRxiv - Developmental Biology 2020Quote: ... the media was replaced with 8 μL of 100x concentrated library lentivirus mixed in 1 mL ESC medium with 1x polybrene (EMD Millipore). 16 h later ...
-
bioRxiv - Immunology 2021Quote: ... A375 and 786O-NL cells by spin-infection (500 g for 2 hours at 37°C) with 8 μg/mL polybrene (Sigma-Aldrich). Four days post-transduction ...
-
bioRxiv - Cell Biology 2021Quote: ... The covalently fluorescently labelled nucleosome arrays used for microinjection were labeled at an 8% fluorophore density (8 in 100 histone2B proteins labeled with a fluorophore) and dialyzed against TE (10 mM Tris-HCl (Sigma-Aldrich), pH 7.4 (Sigma-Aldrich) ...
-
The G2-phase enriched lncRNA SNHG26 is necessary for proper cell cycle progression and proliferationbioRxiv - Molecular Biology 2021Quote: We performed a reverse transduction of both HaCaT and A549 cells by adding lentiviral pHR-SFFV-dCas9-BFP-KRAB or pXPR_120 together with 8 μg/ml polybrene (Sigma-Aldrich, H9268) in DMEM ...
-
bioRxiv - Genetics 2021Quote: ... cells used for immunocytochemistry were seeded at 5-8 x 104 cells per cm2 onto poly-D-lysine (PDL) (Sigma, P7405) and laminin-coated 12 mm glass coverslips in 24-well plates or PDL and laminin-coated clear bottom imaging 96-well plates ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were processed and injected into mice ovary orthotopically (n=8) followed by Doxycycline (2mg/ml) and 10% (w/v) sucrose (Sigma-Aldrich) in drinking water after 1 weeks of cells inoculation ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genotypes were verified by PCR of tail DNA using the RedExtract-N-Amp Tissue PCR Kit (Sigma Aldrich 254-457-8).
-
bioRxiv - Biochemistry 2022Quote: ... mixed 1:1 with fresh medium and added to the desired cells together with 8 μg/ml Polybrene (Sigma, TR-1003).
-
bioRxiv - Cancer Biology 2022Quote: ... were applied to PANC-1 cells in the presence of polybrene (8 µg/ml, Cat. no. TR-1003-G, Sigma-Aldrich) for 48 h ...
-
bioRxiv - Cancer Biology 2022Quote: ... Packaged lentiviruses were then applied to PANC-1 cells in the presence of polybrene (8 µg/ml, TR-1003-G, Sigma-Aldrich) and incubated over- night ...
-
bioRxiv - Bioengineering 2022Quote: ... Filtered particles were either immediately introduced to cells (105 target cells plated in a 6-well plate) in antibiotic-free culture medium supplemented with 8 μg ml-1 polybrene (TR-1003-G, EMD Millipore) or stored in single use aliquots at −80ºC ...
-
bioRxiv - Bioengineering 2022Quote: ... containing guide rail shims made from cured SU-8 2025 photoresist (NC9981681, Kayaku Advanced Materials) and rendered hydrophobic by vapor deposition of ∼1 ml dichlorodimethylsilane (DCDMS, 44072, Sigma-Aldrich) in vacuo for ∼10 mins ...
-
bioRxiv - Bioengineering 2022Quote: ... Finland) uMp-RW3 micromanipulator was used to control the patch pipette (resistance 4-8 MΩ) containing Ames’ solution (A1420, Sigma Aldrich) buffered with 10mM HEPES ...
-
bioRxiv - Biophysics 2022Quote: ... NaCl and indium titanium oxide (ITO) coated glass slides (surface resistivity 8–12 V sq-1) were purchased from Sigma-Aldrich Co ...
-
bioRxiv - Cell Biology 2022Quote: ... and GST proteins were eluted in GST elution buffer (50 mM Tris-HCl pH 8, 10 mM glutathione (Sigma-Aldrich; G4251). The supernatant was separated from the resin to a fresh tube ...
-
bioRxiv - Developmental Biology 2022Quote: ... The pellets were resuspended in aCSF and transferred to Eppendorf tubes pre-coated with 30% BSA (Sigma-Aldrich, 9048-46-8). After cell counting ...
-
bioRxiv - Neuroscience 2022Quote: ... the samples were incubated in 1:30 rat anti-DN-cadherin (DN-EX #8, Developmental Studies Hybridoma Bank) and 1:500 rabbit anti-GABA (A2052, Sigma-Aldrich) or 1:200 rabbit anti-Lucifer yellow (A5750 ...
-
bioRxiv - Microbiology 2022Quote: ... cells seeded in 12-well plates were pre-treated with 500 mU/mL α2-3/6/8 sialidase from Clostridium perfringens (Sigma-Aldrich) for 3 hours at 37°C before infection ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Ear biopsies of mice 4–8 weeks old were incubated at 55°C for overnight in lysis buffer containing 75 mM NaCl (SIGMA, S9888), 25 mM EDTA (Millipore ...
-
bioRxiv - Microbiology 2023Quote: ... Stock cultures were stored at -80°C in cryogenic vials by resuspension of fresh growth in Tryptic Soya Broth (TSB; Oxoid) containing 8% (v/v) dimethyl sulfoxide (Sigma Aldrich). Culture purity was determined by plating frozen stocks onto Tryptic Soy Agar (TSA ...
-
bioRxiv - Plant Biology 2023Quote: ... 5 μL lysate was mixed with 45 μL MUG (methylumbelliferyl b-D-glucuronide) solution (10 mM Tris/HCl pH 8, 2 mM MgCl2, 1 mM MUG (Sigma Aldrich)) in a 96-well plate ...
-
bioRxiv - Genomics 2022Quote: ... K562 or Jurkat cell lines expressing CRISPRi effectors of interest were infected with lentivirus containing sgRNA expression vectors by centrifugation at 1000 × g for 1 h in 24-well plates in the presence of 8 µg/mL polybrene (Sigma-Aldrich). RPE1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The lysates were sonicated on ice with a microtip sonicator (120 W, 8 s on, 2 s off, 3 pulses) and supplemented with 200 U of benzonase (Sigma; E8263). The lysates were cleared by centrifugation (18000 g ...
-
bioRxiv - Molecular Biology 2022Quote: ... were grown in TYG medium (with/without kanamycin; 8 µg/ml) in 96 well microtiter plates after washing with PBS (Nunclon; Sigma-Aldrich). Optical density at 600nm was measured to examine the growth in replicates at 32 °C for 18 h using Synergy H1 Hybrid multi-mode microplate reader ...
-
bioRxiv - Molecular Biology 2022Quote: ... at a constant flow rate of 0.8 ml/min and a constant temperature of 22°C with mobile phase A being 0.4 % acetic acid (Sigma-Aldrich, USA) in water and phase B being 20% Methanol (Honeywell ...
-
bioRxiv - Cancer Biology 2022Quote: LLC cells were treated with conditioned media from inflammasome-induced macrophages as indicated and 5 × 104 cells per well were seeded in top chambers of the transwell chamber (8 μM pore, 24-well plate, Millipore-Sigma) in FBS-free media with membrane inserts ...
-
bioRxiv - Cell Biology 2022Quote: ... filtered through 0.22 μm filter and used to infect HUVECs (passage 2) in the presence of polybrene (8 μg/ml, H9268; Sigma-Aldrich). The transduced HUVECs were selected with puromycin (8ug/ml ...
-
bioRxiv - Microbiology 2023Quote: ... was added for 1 hour at room temperature and quenched with 8 µl of 5% (v/v) of hydroxylamine in water (Sigma Aldrich). 1 μl of 200 mM TCEP was added for 1 hour at 55 °C and free thiol groups were alkylated with 1 μl of 380 mM Iodoacetamide (Thermo Fisher ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The buffer of the combined flowthrough was exchanged into assay buffer (20 mM sodium phosphate, 20 mM sodium chloride, pH 8) using a G25 (Sigma-Aldrich) column ...
-
bioRxiv - Developmental Biology 2023Quote: The anterior lobe of freshly dissected 8 to 12 week-old pituitaries was minced and incubated for 15mn at 37°C in 1mg/ml Papain (Sigma 10108014001), 10μg/ml DNAse I (Sigma 10104159001 ...
-
Neural circuit-wide analysis of gene expression during deafening-induced destabilization of birdsongbioRxiv - Neuroscience 2022Quote: ... Anhydrous 100% ethanol solution was prepared by adding 15 g of molecular sieve beads (Sigma 208582, 3 Å, 8-12 mesh) to 500 mL 100% molecular grade ethanol (Sigma E7023) ...
-
bioRxiv - Microbiology 2023Quote: ... α- chymotrysin from bovine pancreas type II (C4129), 8-Anilino-1-naphthalenesulfonic acid (ANS, A1028) and concanamycin A (ConcA, C9705) were purchased from Sigma Aldrich. HBSS ...
-
bioRxiv - Biophysics 2023Quote: ... Dextran from Leuconostoc spp (Mw 450-650 kg/mol), and poly(ethylene glycol) (PEG 8000, Mw 8 kg/mol) were purchased from Sigma-Aldrich. Chloroform obtained from Merck (Darmstadt ...
-
bioRxiv - Microbiology 2023Quote: ... Infection was maintained in 10% FBS DMEM supplemented with 8 µg ml-1 polybrene infection reagent (#TR- 1003-G, Sigma-Aldrich). Twenty-four hours post-infection cells were washed with PBS and the medium was refreshed with complete culture medium ...
-
bioRxiv - Microbiology 2023Quote: ... 5 or 10 μM nocodazole supplemented 10% FBS DMEM medium with 8 µg mL-1 polybrene infection reagent (#TR-1003-G, Sigma-Aldrich). Seven hours after transduction ...
-
bioRxiv - Immunology 2023Quote: ... digested with 0.1% trypsin (Wisent Inc., Canada) for 8 min and then transferred into 0.8 mg/mL Collagenase Type I (Sigma-Aldrich, USA) for 60 min at 37 °C and 5% CO2 with regular vigorous shaking in a humidified incubator ...
-
bioRxiv - Immunology 2023Quote: ... 100,000 T84 cells per well were seeded on glass bottom 8-well chamber slides coated with 2.5% human collagen (Sigma #C5533-5MG) diluted in water ...
-
bioRxiv - Immunology 2023Quote: ... we used a well-established approach based on the fluorescent molecular probe 8-anilino-1-naphthalenesulfonic acid (ANS, Fluka, Sigma-Aldrich) which changes its fluorescence properties upon interaction with hydrophobic molecular environment in proteins ...
-
bioRxiv - Neuroscience 2023Quote: ... Tg37+/- whole hippocampus non-cell specific nascent translatome labelling was accomplished with 4mM AHA (Fluorochem, # 942518-29-8) mixed with 5% Maltose (Sigma, M9171) in drinking water and in a mash diet from 9 w.p.i to 10 w.p.i ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2×105 target tumour cells were seeded in 6 well plates and infected with lentiviruses + polybrene (8 µg/mL) before selection of transduced cells using 4ug/mL puromycin (Sigma-Aldrich).
-
bioRxiv - Bioengineering 2023Quote: ... cells were centrifuged at 300 g for 5 minutes and resuspended in Essential 8 Flex medium containing 2 µM ROCK inhibitor Thiazovivin (Millipore Sigma). hPSCs were then counted using a Moxi Cell Counter (Orflo Technologies ...
-
bioRxiv - Molecular Biology 2023Quote: ... 150 μL cell suspension was mixed with 150 μL DB+ containing 8 mM caffeine (Wako) and 20 μM latrunculin A (Sigma-Aldrich) and placed on a 35-mm glass bottom dish (12-mm glass in diameter ...
-
bioRxiv - Molecular Biology 2023Quote: ... MCF10A cells were infected for 24 h using filtered viral supernatant diluted with culture medium and supplemented with 8 µg/µl protamine sulphate (Sigma-Aldrich). Selection of infected cells with antibiotics was performed 48 h after the infection.
-
bioRxiv - Microbiology 2023Quote: NIH3T3 and BMDC cells were infected with MLV (genome equivalent of a multiplicity of infection [MOI] of 1) in the presence of 8 mg/ml Polybrene (Sigma-Aldrich), and cells were incubated on ice for 1 h to allow virus binding ...
-
bioRxiv - Microbiology 2023Quote: ... cells were transduced with HIV-TOP opt mChΔW lentivirus containing the PIKA library by spinoculation in the presence of 8 µg/mL protamine sulfate (Millipore Sigma #P3369). Two days later (Experiment Day 4) ...
-
bioRxiv - Pathology 2023Quote: ... The cells were infected with lentiviruses carrying the plasmid (MOI = 6) in the presence of Hexamethidine Bromide (8 µg/mL; Sigma-H9268) for 24 hours ...
-
bioRxiv - Neuroscience 2022Quote: ... osm-9 gDNA was amplified with the primers KLB289 (GTTGTTTACCTTTTATGTTCATCCG) and KLB290 (AAATTTTCTACTGCCTGGTATCAAA) off of phenol-extracted followed by ethanol precipitated whole-worm gDNA (Phenol pH 8 from Sigma Aldrich). The osm-9 gDNA fragment plus extra upstream and downstream homologous sequence was amplified off of the gDNA amplified with KLB289 and KLB290 ...