Labshake search
Citations for Millipore Sigma :
2401 - 2450 of 10000+ citations for 7 Chlorothieno 2 3 c pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... 0.1 mM EDTA, 10 mM KCl, 1x Complete® [Roche, 1697498], 1 mM DTT, 1x phosphatase inhibitor cocktails 2 and 3 [Sigma Aldrich, P5726/P0044]). After incubation on ice for 15 min ...
-
bioRxiv - Neuroscience 2021Quote: Differentiated human neural cultures (2 months old) were transduced with 250 µl of Auto-hLAG3 LV and 3 µg/ml of polybrene (Sigma-Aldrich #TR-1003-G) per well of a 6 well plate ...
-
bioRxiv - Bioengineering 2020Quote: ... Aortas were then washed in 78% methanol for 5 minutes under gentle movement for a total for 3 times before incubating in a 2% ORO solution (Sigma-Aldrich, St Louis, MO) for 60 minutes ...
-
bioRxiv - Neuroscience 2020Quote: ... one containing 20% ethanol adulterated with 100 μM (Days 1 and 2) or 250 μM (Day 3) quinine hemisulfate (Sigma-Aldrich, St. Louis, MO) and the other containing water ...
-
bioRxiv - Neuroscience 2021Quote: ... The larvae were then optically cleared by replacing ethanol with ethyl cinnamate (ECi; Ethyl 3-phenyl-2-propenoate; Sigma-Aldrich, order no. 112372-100G). After 30-60 min of incubation ...
-
bioRxiv - Neuroscience 2020Quote: Protein lysates were extracted from the hippocampi or cortices of adult mice and dissected in ice-cold PBS containing Phosphatase Inhibitor Cocktails 2 and 3 (Sigma-Aldrich, St. Louis, MO) and Mini-Complete Protease Inhibitor Cocktail (Roche Diagnostics ...
-
bioRxiv - Molecular Biology 2024Quote: ... treated with lysis buffer (RIPA buffer, 1x Roche Complete Protease Inhibitor cocktail, 1X Sigma Phosphatase Inhibitor Cocktail 2, and 1X Sigma Phosphatase Inhibitor Cocktail 3), and incubated on ice for 30 minutes ...
-
bioRxiv - Developmental Biology 2024Quote: ... The cells were washed with DPBS five times for 3 min each, and stained with 4’, 6-diamidino-2-phenylindole (DAPI, 1 μg/mL in PBS) (Sigma, San Francisco, CA, USA) in the dark at room temperature for 8 min ...
-
bioRxiv - Cell Biology 2024Quote: Alveolar organoids were removed from Matrigel by mechanical dissociation with a cut pipette tip or retrieved from HA hydrogels with 2% hyaluronidase (Sigma Catalog #37326-33-3) for 30 minutes at 37°C followed by mechanical dissociation with a pipette tip ...
-
bioRxiv - Cell Biology 2024Quote: ... Permeabilization buffer was removed and washed 3×2 minutes before blocking for 1 hour at room temperature in a 1% Bovine Serum Albumin (BSA) (Millipore Sigma, cat: 2910-OP) in DPBS solution ...
-
bioRxiv - Physiology 2023Quote: 25-30 mg of frozen powdered liver tissue was used to extract liver lipids as described previously 34 and reconstituted in a tert-butanol-Triton X solution (3:2) and liver triglycerides and cholesterol levels were measured via a commercially available kit (Sigma-Aldrich, St. Louis, MO).
-
bioRxiv - Microbiology 2023Quote: ... The reaction was stopped by the addition of 28 μl of a stop reaction mixture: 3 μl of the reducing reagent (mixture of 0.2 g 1-amino-2-naphtol-4-sulfonic acid (Millipore-Sigma, Burlington, MA, USA, #08751) with 0.2 g sodium bisulfite (Millipore-Sigma ...
-
bioRxiv - Cancer Biology 2023Quote: ... des-Arg9-Leu8]-BK (B1R antagonist) and 3-(5′-Hydroxymethyl-2′-furyl)-1-benzyl indazole were purchased from Sigma-Aldrich (St. Louis, MO, USA). 8-Bromoguanosine 3′ ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... an isolated infrarenal aortic segment of C57BL/6J mice was perfused with sterile isotonic saline containing type I PPE (2-3 U/ml, E1250, Sigma-Aldrich, Burlington, MA, USA) for 5 min under pressure (120 mmHg ...
-
bioRxiv - Biophysics 2023Quote: ... was purchased from MedChem-Express (Monmouth Junction, NJ, USA). The phospholipid 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC, see Fig. 1) was purchased from Sigma-Aldrich (Merck KGaA, Germany). Potassium bromide (KBr) ...
-
bioRxiv - Neuroscience 2023Quote: ... 215 uL of either ice-cold 20mM Tris-HCl/2 mM MgCl2/0.5% Triton X-100 with protease inhibitor (Pierce #A32953) and phosphatase inhibitor cocktail 3 (Sigma #P0044; Buffer #1, Bf#1) or boiling 1%SDS/50mM NaF (Buffer #2 ...
-
bioRxiv - Physiology 2023Quote: ... In order to substitute cholesterol in the patch with cholest-4-en-3-one (cholestenone) the bath solution was replaced with 2 mM MBCD solution saturated with cholest-4-en-3-one (Millipore-Sigma, St. Louis, MO).
-
bioRxiv - Microbiology 2023Quote: ... freshly drawn whole blood was mixed with an equal volume of a solution containing 3% dextran (Sigma-Aldrich, ACS Cas.# 9004-54-2, Denmark) and 1.8% sodium chloride (Fisher Scientific ...
-
bioRxiv - Bioengineering 2024Quote: ... a 5 µL drop of the formulation was placed on a glass slide that was silanized by liquid phase deposition in a solution of 2% 3-(trimethoxysilyl)propyl methacrylate (cat. #M6514, Sigma-Aldrich, Oakville, Ontario, Canada) prepared in toluene (cat ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and 3 (10 mg/kg) intraperitoneally (i.p.) 30 min prior to injection of zymosan (Sigma-Aldrich; 2 mg/ml in saline, 0.5 ml, i.p.). Mice were sacrificed (by CO2 inhalation ...
-
bioRxiv - Cell Biology 2024Quote: ... Phase separation of lipids from the serum was performed using an organic phase of diisopropyl ether: n-butanol (3:2; Sigma Aldrich, 296856, B7906, respectively). Organic and aqueous phases were allowed to mix at room temperature with continuous stirring in the dark for 1 h ...
-
bioRxiv - Molecular Biology 2024Quote: ... then fully resuspended in 1 mL cold resuspension buffer supplemented with 1% each phosphatase inhibitor cocktails 2 and 3 (Sigma Cat #P5726 and P0044). To lyse the resuspended cells ...
-
bioRxiv - Immunology 2021Quote: ... cells were treated at 37°C with 0.5U/ml neuraminidase (C. perfringens, Sigma) to remove sialic acid ...
-
bioRxiv - Cell Biology 2022Quote: ... 2-hydroxy-4’-(2- hydroxyethoxy)-2-methylpropiophenone (I2959) (Sigma-Aldrich, USA), a photoinitiatior (0.5% w/v ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2% (v/v) 2-mercaptoethanol and 2 mM PMSF) (Sigma-Aldrich) and homogenize ...
-
bioRxiv - Neuroscience 2020Quote: Animals were anesthetized with avertin (2, 2, 2-Tribromoethanol (Sigma-Aldrich), 125-250 mg/kg ...
-
bioRxiv - Cell Biology 2022Quote: ... 2-Aminoethyl diphenylborinate (2-APB; Sigma), caffeine (Sigma) ...
-
bioRxiv - Neuroscience 2023Quote: ... 2-Deoxyglucose (2-DG, Sigma #D6134) was administered via IP injection at 0.5 mg/g bodyweight ...
-
bioRxiv - Bioengineering 2020Quote: The secreted proteins from different strains were analyzed for cellulase and -mannanase activity as well as reducing sugar yield at three different condition of temperature (30°C, 40°C and 50°C) using carboxymethyl cellulose or locust bean gum as a substrate (Sigma-Aldrich Co.). The activity assay was determined by using 3,5-dinitrosalicylic acid (DNS ...
-
bioRxiv - Immunology 2023Quote: ... were slowly (-1°C/min) frozen down to -80°C in a isopropanol alcohol-walled freezing unit (Nalgene Mr. Frosty: C-1562 Sigma-Aldrich, USA) before being transferred to 25-vial boxes in liquid nitrogen.
-
bioRxiv - Plant Biology 2020Quote: ... and histidine but supplemented with 2.5 mM 3-AT (3-Amino-1,2,4-triazole; Sigma) for 4 days at 28°C.
-
bioRxiv - Genomics 2019Quote: ... with primers 5’ GAGCTGGACGGCGACGTAAACG 3’ and 5’ CGCTTCTCGTTGGGGTCTTTGCT 3’ for amplification (Sigma-Aldrich, Germany). The PCR amplification was as follows ...
-
bioRxiv - Cell Biology 2019Quote: ... washed 3 times in PBS before incubation in PBS supplemented with 3% BSA (Sigma) for 30 min to block non-specific antibody binding ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.12 g (6.25 mmol) of 1-ethyl-3-(3-dimethyllaminopropyl) carbodiimide HCl (Sigma Aldrich) was added to the flask containing 0.98 g (2.7 mmol ...
-
bioRxiv - Plant Biology 2020Quote: ... (±)-3-Hydroxydecanoic acid (3-OH-C10:0) and chitin were obtained from Sigma-Aldrich. All elicitors were dissolved in deionized MilliQ sterile water at the respective stock concentration of 1mM for flg22Pa ...
-
bioRxiv - Neuroscience 2021Quote: ... histone 3 lysine 27 tri-methylation (H3K27me3) and histone 3 antibodies (all from Millipore). Positive bands were detected by chemiluminescent reagents (Thermofisher ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 3-uncoupled (3U) after sequential addition of 3 mM ADP (Sigma-Aldrich A5285), 4 μM oligomycin (Sigma-Aldrich C75351) ...
-
bioRxiv - Immunology 2022Quote: ... containing 0.25% with 3-[(3-cholamidopropyl) dimethylammonio]-1-propanesulfonate (CHAPS) (Sigma, St. Louis, MO) for two minutes at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... 4% 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate hydrate (CHAPS; Sigma-Aldrich, Cat. No. 226947)] ...
-
bioRxiv - Neuroscience 2023Quote: ... Two pulse applications of 3 µM of GSK-3 Inhibitor CHIR99021 (Merck Millipore, 361571) were done on days 13 and 14 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Two pulse applications of 3 μM of GSK-3 Inhibitor CHIR99021 (Merck Millipore, 361571) were done on days 13 and 14 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 98% EDC [1-(3-Dimethylaminopropyl)-3-ethyl carbodiimide hydrochloride] were purchased from Sigma Aldrich. SYBR Safe nucleic acid gel staining dye was obtained from Invitrogen (Fisher Scientific ...
-
bioRxiv - Developmental Biology 2023Quote: ... and (3) 3 hrs at RT in 0.1% Direct Red 23 (212490, Sigma-Aldrich), in PBST ...
-
bioRxiv - Genomics 2020Quote: ... cells were grown to early log phase (OD600 0.1–0.2) overnight at 23°C and arrested in G1 using the pheromone α factor at a concentration of 10 μM (Sigma Aldrich T6901-5MG) for 2.5h ...
-
bioRxiv - Cell Biology 2021Quote: ... HeLa cells were seeded at a density of 2.5×106 cells/well in 12-well plates and spin-fected (2000 rpm for 2 hours at 37°C) with increasing concentrations of virus in the presence of 8µg/mL polybrene (Millipore TR-003-G lot#3287963). The next day ...
-
bioRxiv - Bioengineering 2022Quote: ... 90°C), incubation time (1 min, 2 min) and permeabilization status (with or without incubation in 0.05% Triton-X [Sigma] in PBS for 10 min) were tested (Figure 2B) ...
-
bioRxiv - Genetics 2019Quote: ... skimmed milk in PBS at the following concentrations for 2-20 h at 4°C (anti-Srs2, Santa Cruz sc-1191, 1:2000; anti PSTAIR, Sigma P6962, 1:2500). Membranes were washed 3x in PBS ...
-
bioRxiv - Immunology 2022Quote: ... Eluted samples were dried completely by CHRIST RVC 2-25 centrifuge at 45° C and resuspended in 15 μl 0.1 % formic acid (Sigma-Aldrich, Saint Louis MO USA), vortexed and sonicated in an ultrasonic water bath for 10 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... Supernatants were used for purification of recombinant proteins by 2 h incubation with GST-agarose beads at 4 °C according to manufacturer’s protocol (Sigma Aldrich, St. Louis, USA, G4510). SDS-PAGE electrophoresis was used to check level of expression and purity of purification.
-
bioRxiv - Immunology 2023Quote: ... then livers were harvested and placed in 2% paraformaldehyde for 24 hours at 4°C then placed in 30% sucrose (Sigma-Aldrich Cat. No. S1888) in PBS for 48 hours at 4°C ...