Labshake search
Citations for Millipore Sigma :
151 - 200 of 2130 citations for DNA Polymerase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: All PCR reactions used for cloning were performed with high fidelity KOD Hot Start DNA Polymerase (EMD Millipore). Approximately 100 bp of upstream flanking DNA and the coding regions of OG1RF_10820 ...
-
bioRxiv - Cell Biology 2021Quote: ... The two tensin fragments were amplified individually by PCR using KOD Xtreme™ Hot Start DNA Polymerase (Sigma) and were run on 1% agarose gel along with the linearized vector ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 mM MgCl2, 0.002% gelatin, 0.4 mM dNTP mix, 0.06 unit/ml of Taq DNA Polymerase, Sigma Aldrich) and 0.5 μM of each primer ...
-
bioRxiv - Microbiology 2022Quote: ... tuberculosis H37Rv genomic DNA by polymerase chain reaction (PCR) using primers that were synthesized by Sigma (Table S3). Hybrid combinations of genes or introduction of affinity tags were achieved with the use of nested primers ...
-
bioRxiv - Biophysics 2019Quote: ... Mutagenesis was a carried out by a single PCR reaction using the KOD Hot Start DNA polymerase (Novagen) and appropriate mutagenic oligonucleotides (Sigma) ...
-
bioRxiv - Microbiology 2023Quote: ... We used the PR8 pDZ-HA plasmid as a template and Kod Hot start DNA polymerase (Millipore Sigma). We followed the manufacturer’s recommendations to PCR mutagenize the pDZ-HA open reading frame ...
-
bioRxiv - Microbiology 2023Quote: ... We used the pH28D14 HC and LC plasmids as templates and Kod Hot start DNA polymerase (Millipore Sigma). We followed the manufacturer’s recommendations to PCR mutagenize the VH and VL gene segments ...
-
bioRxiv - Cancer Biology 2021Quote: ... Coding region of H3.1 along with Flag-Tag was amplified by PCR using KOD Hot Start DNA Polymerase (Millipore) and cloned into gateway entry vector pENTR/D-TOPO vector (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... the TAR vectors were PCR amplified from pCC1BAC-his3 with KOD Xtreme Hot Start DNA polymerase (Millipore, Burlington, MA) using the construction primers (labeled “Con” ...
-
bioRxiv - Plant Biology 2021Quote: ... a 2.25-kb fragment containing the PHOT1 CDS was amplified by PCR with KOD hot start DNA polymerase (Novagen) using PHOT1 FW and PHOT1 RV primers (Table 1) ...
-
bioRxiv - Plant Biology 2019Quote: ... The amplification of ALBA genome sequences was carried out with high-fidelity KOD Hot Start DNA Polymerase (Merck Millipore), according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... Puromycin or neomycin-resistant cell clones were screened by genomic PCR using KOD Xtreme hot-start DNA polymerase (Millipore).
-
bioRxiv - Biochemistry 2022Quote: ... with KOD polymerase (Novagen) according to manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... with KOD polymerase (Novagen). cDNA constructs for human Parkin mutant expression were amplified in Escherichia coli DH5α and purified using a NucleoBond Xtra Midi kit (#740420.50 ...
-
bioRxiv - Biochemistry 2021Quote: ... with KOD polymerase (Novagen). cDNA constructs for mammalian tissue culture (Supplementary Table 1 ...
-
bioRxiv - Biochemistry 2019Quote: ... with KOD polymerase (Novagen). All DNA constructs were verified by DNA sequencing ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... We carried out polymerase chain reactions (PCRs) with Hot Start polymerase (MERCK MILLIPORE) and performed colony PCRs with Taq polymerase (NEB) ...
-
bioRxiv - Cancer Biology 2021Quote: ... A 550 bp region from the mouse (FVB/NJ and BALB/cJ) Nup210 promoter covering the polymorphic sites was amplified by PCR using KOD Hot Start DNA Polymerase (Millipore) and digested with KpnI (New England Biolabs ...
-
bioRxiv - Plant Biology 2021Quote: The coding sequences of most of the 44 non-pseudogene AtUMAMIT were amplified by PCR (oligonucleotide sequence is provided in Supplemental Table 1) by using the KOD Hot Start DNA Polymerase kit (Novagen) from a mix of reverse-transcribed RNA extracted from seedlings and inflorescences ...
-
bioRxiv - Microbiology 2022Quote: Genes for pbps were amplified with Phanta Max Super-Fidelity DNA Polymerase (Vazyme) and primers ordered from Sigma (Table S2). Equimolar quantities of PCR products were used for transformation ...
-
bioRxiv - Molecular Biology 2020Quote: ... was used to produce cDNA from 1 μg of RNA and subsequent amplification was obtained with the KOD hot start DNA polymerase (Novagen). Plxdc2 was amplified with the following primers ...
-
bioRxiv - Microbiology 2020Quote: ... The fragments were amplified with Phusion HotStart II DNA polymerase and were cloned into LIC-vector (LIC, ligation independent cloning) pET46EkLIC (Novagen). The ligation products were transformed into NovaBlue competent cells ...
-
bioRxiv - Microbiology 2021Quote: ... and SsuT3-oE-R (5′-AGTCAG GGATCC CTA CAC CAC CTT CAC TTT GGT ACC) with KOD Hot Start DNA polymerase (Merck Millipore) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... Conserved regions were amplified from genomic leaf DNA in a standard polymerase chain reaction (PCR) using specific primers synthesized commercially (Sigma). PCR products were labeled with biotin-16-dUTP or digoxigenin-11-dUTP using BioPrime CGH array labelling kit (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: ... 1.3×106 copies of the PCR product from the mixture above were added into the second round PCR (KOD Hot Start DNA Polymerase, Novagen) to add the adapter for sequencing ...
-
bioRxiv - Microbiology 2020Quote: ... primers 1022700 5F and R were used to amplify the 572 bp 5’ homology flank and primer pair 1022700 3F and R was used to amplify the 673 bp 3’ homology flank (KOD Hot Start DNA Polymerase, Merck Millipore) which were cloned on either side of the sfGFP expression cassette in pkiwi003 (Ashdown et al. ...
-
bioRxiv - Microbiology 2019Quote: ... cDNA clones of VF1-mutant viruses that included either a single or a triple stop codon in ORF4 were generated by PCR mutagenesis using KOD hot start DNA polymerase (Novagen). The MNV-3 M1 mutant was generated by inserting a stop codon ...
-
bioRxiv - Genetics 2021Quote: ... Purification of genomic Polymerase Chain Reaction (PCR) amplified DNA was performed with the GenElute PCR Clean-Up kit (Sigma-Aldrich) or the GeneJET PCR Purification Kit (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2020Quote: ... CRISPR-targeted regions were amplified with MiSeq-compatible gene-specific primers containing Read1 and Read2 adaptor sequences (IDT) using KOD DNA polymerase Hot start kit (TOYOBO/Millipore). The second PCR was performed with index adaptor primers compatible with Ilumina MiSeq (i5 and i7 primers ...
-
bioRxiv - Cancer Biology 2022Quote: ... Plasmid cDNA barcode sequences were amplified using primers containing indexed Illumina sequencing adaptors (Extended Data Table 10) using KOD Hot Start DNA Polymerase (Novagen). Amplicons were purified using Agencourt AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Microbiology 2022Quote: ... NSm and the entire pcDNA3.1 vector encoding Gn with an N-terminal SS plus HA tag were amplified by PCR using KOD Hot Start DNA polymerase (Novagen), mixed and then concatenated using the NEBuilder HiFi assembly kit according to the manufacturer’s instructions to yield pSnH-OROV-M ...
-
bioRxiv - Microbiology 2023Quote: ... gene was PCR amplified from individual spores with primers AML225 (GAACCCAAACACTTTGGTTTCC) and WANDA26 (CAGCCGCGGTAATTCCAGCT) using JumpStart RedTaq DNA Polymerase Master Mix (Sigma). PCR products were sent for cleaning and Sanger sequencing (Macrogen Europe) ...
-
bioRxiv - Cell Biology 2022Quote: GEMC1 and MCIDAS were amplified from FLAG-hBirA*-GEMC1/MCIDAS using forward primers and reverse primers containing SpeI-XhoI restriction sites (GEMC1 F– AAAAACTAGTatggactacaaagacgatgac, R- TTTTCTCGAGCTAAGACTGCTTAGGGACCCA), (MCIDAS, F– AAAAACTAGTatggactacaaagacgatg, R- TTTTCTCGAGTCAACTGGGGACCCAGCGGAAC) using KOD Hot Start DNA Polymerase (Millipore) and cycling conditions recommended from the manufacturer (polymerase activation at 95 °C for 2 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... Genotyping of mutant fish was performed by isolating genomic DNA from adult fish by swabbing64 and running PCR using KOD HotStart polymerase (Novagen) following standard protocol with 100 ng of DNA ...
-
bioRxiv - Plant Biology 2024Quote: ... a 188 bp cDNA fragment of MtABCG40 5’UTR or a 200 bp cDNA fragment of MtLOG3 3’UTR were amplified with KOD Hot Start DNA Polymerase (Novagen) and cloned into pDONR/Zeo vector (Thermo Fisher ...
-
bioRxiv - Biochemistry 2024Quote: ... The BCL11A enhancer DHS +58 on-target region was amplified with KOD Hot Start DNA Polymerase (EMD-Millipore, 71086-31) and corresponding primers (forward primer 5’-AGAGAGCCTTCCGAAAGAGG-3’ and reverse primer 5’ GCCAGAAAAGAGATATGGCATC-3’) ...
-
bioRxiv - Cell Biology 2024Quote: ... PLA signals were amplified by incubating cells with DNA polymerase for 100 min at 37°C (DUOLINK in Situ detection reagent red, DUO92008, Sigma). Confocal images were acquired using a Leica laser scanning confocal microscope and analyzed via Fiji software as previously described (19).
-
bioRxiv - Evolutionary Biology 2021Quote: ... Amplification used Jumpstart polymerase (Sigma) and the following cycling protocol ...
-
bioRxiv - Microbiology 2021Quote: ... using KOD polymerase (EMD Millipore). Reactions were conducted following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... SP6 RNA polymerase (Sigma, 10810274001), and template cDNAs and purified using SigmaSpin Sequencing Reaction Clean-Up (Sigma ...
-
bioRxiv - Bioengineering 2021Quote: ... PduN point mutants at glycine 52 (G52) were generated using QuikChange site-directed mutagenesis with KOD Hot Start DNA polymerase (Sigma Aldrich) on a PduN sequence ...
-
bioRxiv - Cell Biology 2021Quote: ... CDC50.3 and CDC50.4 were generated using a PCR fragment encoding the mAID–HA and the HXGPRT cassette produced using the KOD DNA polymerase (Novagen, Merck) with the vector pTUB1:YFP-mAID-3HA as template and the primers indicated in Table S2 ...
-
bioRxiv - Neuroscience 2019Quote: cDNAs templates were synthesized from extracted total RNA using omniscript reverse transcriptase (Quiagen) and used to perform PCR amplification under the indicated conditions using Taq DNA polymerase (Sigma-Aldrich).
-
bioRxiv - Cell Biology 2020Quote: ... All progenies of genetic crosses were verified by diagnostic PCR using KOD XTREME Hot Start DNA Polymerase (71975-3, EMD Millipore) or OneTaq® Hot Start Quick-Load® 2X Master Mix with Standard Buffer (M0488L ...
-
bioRxiv - Developmental Biology 2020Quote: The LINC00261 wild type cDNA was PCR-amplified from pENTR/D-TOPO-LINC00261 (gift from Leo Kurian) with KOD Xtreme™ DNA Hotstart Polymerase (Millipore). The resulting PCR product was inserted into pRRLSIN.cPPT.PGK-GFP.WPRE via its appended BshTI/SalI cloning sites ...
-
bioRxiv - Molecular Biology 2020Quote: ... Libraries were PCR-amplified in 40 μL reactions with 15-18 cycles using KOD Hot Start DNA polymerase (Millipore, 71086-3) and 500 nM of each primer P1.3 and P2.1 (synthesized by IDT ...
-
bioRxiv - Molecular Biology 2020Quote: The DNA templates for the in vitro transcription were obtained by Taq polymerase extension of chemically synthesized overlapping oligodeoxyribonucleotides (Sigma-Aldrich) (Supplemental Table S1) ...
-
bioRxiv - Microbiology 2020Quote: ... HiaBD1-F and HiaBD1-R were used to amplify BD1 from NTHi strain R2866 genomic DNA using KOD hot-start polymerase (EMD Millipore) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... Plasmids were then extracted and used as template in ~400 bp NGS amplicon generation PCR reactions using KOD Xtreme Hot Start DNA Polymerase (EMD Millipore). The amplicons were gel-extracted using the Monarch DNA Gel Extraction kits (NEB) ...
-
bioRxiv - Microbiology 2022Quote: ... a first PCR was performed using the templates and primers shown in Table 1 with KOD hot start DNA polymerase (Sigma-Aldrich), with annealing time of 30 seconds at the indicated temperature ...