Labshake search
Citations for Millipore Sigma :
451 - 500 of 2130 citations for DNA Polymerase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2020Quote: ... and the DNA with DAPI (Sigma).
-
bioRxiv - Molecular Biology 2020Quote: ... RNA oligonucleotides were purchased from Eurogentec and DNA oligonucleotides from Sigma-Aldrich. All oligonucleotides were HPLC purified ...
-
bioRxiv - Bioengineering 2022Quote: ... single strand DNA (Sigma-Aldrich, D8899) were coated onto 96-well half-area high- binding ELISA plates (Corning ...
-
bioRxiv - Biophysics 2022Quote: ... Calf thymus DNA (ctDNA) (Sigma-Aldrich) was dissolved following the manufacture’s instructions to obtain a 1 mg/ml stock solution ...
-
bioRxiv - Cell Biology 2019Quote: ... with calf thymus DNA (D4764, Sigma) as reference.
-
bioRxiv - Bioengineering 2021Quote: ... single strand DNA (Sigma-Aldrich, D8899) were coated onto 96-well half-area high-binding ELISA plates (Corning ...
-
bioRxiv - Biochemistry 2022Quote: ... DNA primers were purchased from Sigma.
-
bioRxiv - Synthetic Biology 2020Quote: Calf thymus DNA (Sigma D1501-100MG) was diluted in 10 mM Tris-Acetate pH 8 ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was counterstained with DAPI (Sigma) and actin labelled with TRITC-conjugated phalloidin ...
-
bioRxiv - Immunology 2019Quote: HPLC-grade DNA oligos (Sigma-Aldrich) were dissolved in sterile endotoxin-free water ...
-
bioRxiv - Systems Biology 2021Quote: ... DNA was labeled with Hoechst33342 (Sigma). Images were collected using a 63X ...
-
bioRxiv - Microbiology 2020Quote: ... and herring sperm DNA (Sigma Aldrich). Probes were resuspended in 10 μL formamide ...
-
bioRxiv - Immunology 2020Quote: ... double stranded DNA (Sigma-Aldrich; D4522), insulin (Sigma-Aldrich ...
-
bioRxiv - Genomics 2021Quote: ... ordered as complementary DNA oligonucleotides (Sigma) with overhangs for BbsI ...
-
bioRxiv - Immunology 2022Quote: ... HT-DNA (Sigma-Aldrich, Cat#D6898), Lipofectamine 2000 (Life Technologies ...
-
bioRxiv - Immunology 2022Quote: ... DNA using DAPI (Sigma-Aldrich, USA) and F-actin using Alexa Fluor 680 phalloidin (ThermoFisher Scientific) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and DNA with DAPI (D9542, Sigma). Appropriate secondary antibody was FITC-conjugated donkey-anti-rabbit immunoglobulins (Jackson Laboratories) ...
-
bioRxiv - Cell Biology 2023Quote: ... DNA (Millipore Sigma #CBL186, 1:200). Secondary antibodies conjugated to Alexa 405 ...
-
bioRxiv - Immunology 2023Quote: ... double stranded DNA (dsDNA) (Sigma, D4522), single stranded DNA (ssDNA ...
-
bioRxiv - Cell Biology 2022Quote: ... and anti-DNA (Sigma; 1:800) antibodies in 40 µL PBS for 30 min at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 10.7μg plasmid DNA (Sigma Aldrich; MX1 (#3 ...
-
bioRxiv - Developmental Biology 2023Quote: ... DNA dye was Hoechst (Sigma-Aldrich B2261 used 1:5000 from a stock solution at 10 mg/ml) ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA-RNA hybrid (Sigma-Aldrich, MABE1095), and anti-DNA PKcs (phospho S2056 ...
-
bioRxiv - Biochemistry 2024Quote: ... DNA primers were purchased from Sigma. Synthesis of N-acetyl-1-seleno-β-D-glucosamine (SeGlcNAc ...
-
bioRxiv - Molecular Biology 2022Quote: ... a 100ml culture was harvested for DNA extraction using GeneElute –Mammalian Genomic DNA Miniprep Kit (Sigma- Aldrich). PCRs were done on different genomic regions flanking an IES.
-
bioRxiv - Microbiology 2022Quote: ... genomic DNA was prepared using the GenElute Bacterial Genomic DNA Kit (Sigma-Aldrich, St. Louis, Missouri, USA) according to the manufacturer’s guidelines and sequenced at the Microbial Genome Sequencing Center (MiGS ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 6 μg of female-derived competitive DNA and 50 µg of sonicated salmon sperm DNA (Sigma-Aldrich). Each ethanol-precipitated probe mixture was dissolved in 20 μL of the hybridization buffer (for composition ...
-
bioRxiv - Biochemistry 2019Quote: TtClpP DNA was directly amplified from Thermus thermophilus HB8 DNA and cloned in to a pet41c (Novagen) expression vector with NedI and XhoI restriction enzymes ...
-
bioRxiv - Cell Biology 2021Quote: ... genomic DNA was extracted from clonal cell lines using the GenElute Mammalian Genomic DNA kit (Sigma-Aldrich) and the K6a and K6b gene fractions where the indel mutations were expected were amplified by PCR ...
-
bioRxiv - Developmental Biology 2022Quote: ... genomic DNA from EpiLC at D3 was isolated using the GenElute Mammalian Genomic DNA Miniprep Kit (Sigma) with RNase treatment ...
-
bioRxiv - Microbiology 2023Quote: The extraction of bacterial genomic DNA was performed using the GenElute Bacterial Genomic DNA kit (Sigma Aldrich), according to the instructions of the manufacturer.
-
bioRxiv - Developmental Biology 2023Quote: ... Add 0.5μL of live cell DNA stain (Vybrant DyeCycle Violet DNA Stain, Invitrogen or Hoechst 33342, Sigma) and 1.2 μL of 10mg/mL Propidium Iodide (PI ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... DNA was complemented to a total amount of 2 µg DNA per dish with ssDNA (Sigma Aldrich). After 24 h cells were transferred in 96 well plates (Greiner ...
-
bioRxiv - Microbiology 2024Quote: ... DNA extraction was performed as described by the GenElute Bacterial Genomic DNA Kit (Sigma-Aldrich, Darmstadt, Germany) using the kit’s columns and reagents following the protocol for Gram-positive bacteria for all samples ...
-
bioRxiv - Microbiology 2019Quote: ... a source of T7 RNA Polymerase was provided by co-transforming another plasmid pAR1219 (Sigma-Aldrich, St. Louis, MO). The plasmids pACD4K-C::emtA and pAR1219 were maintained by selection on chloramphenicol and ampicillin ...
-
bioRxiv - Neuroscience 2019Quote: ... Amplification and label probe binding was performed after further washes with wash buffer A with the amplification reaction mixture containing Phi29 polymerase and the fluorophore-labeled detection oligo prepared according to the manufacturer’s recommendations (Duolink Detection reagents Red, Sigma) in a prewarmed humidified chamber at 37 °C for 100 min ...
-
bioRxiv - Biophysics 2020Quote: The N414A and N414Q mutations in AsLOV2 were created in the pET15b-AsLOV2 and pHis-Gβ1-Parallel-AsLOV2 constructs using the QuickChange method and KOD HotStart polymerase (Novagen).
-
bioRxiv - Microbiology 2021Quote: ... while PCRs to generate specific knock-in constructs (mAID fusions and epitope tagging) were performed with KOD polymerase (Novagen). Specific gRNA were generated using the Q5 site-directed mutagenesis kit (New England Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA Polymerase inhibitors were added to cells for 24 h at the following concentrations: BMH-21 (RNAPI inhibitor; Millipore) at 1 µM ...
-
bioRxiv - Immunology 2021Quote: ... The PCR products were used to synthesize dsRNA using a T7 RNA Polymerase Kit (Sigma-Aldrich RPOLT7-RO ROCHE). Generated dsRNAs were treated with TURBO DNA-free Kit (Invitrogen ...
-
bioRxiv - Developmental Biology 2023Quote: ... antisense probes were made using the appropriate T3/T7/SP6 RNA polymerases and the DIG labelling mix (Roche/Sigma), following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... dsRNA was synthesized overnight at 37°C using T7 RNA polymerase (FisherBiosci) in transcription buffer (40 mM Tris-HCl pH 8.0; 10 mM DTT; 2 mM Spermidine-HCl (Sigma); 20 mM MgCl2 ...
-
bioRxiv - Biophysics 2021Quote: ... The DNA-echinomycin complexes were prepared by mixing DNA duplexes in NMR buffer with 3x echinomycin (Sigma-Aldrich) dissolved in methanol ...
-
bioRxiv - Molecular Biology 2020Quote: ... genomic DNAs were isolated from clonal populations using GenElute(tm) Mammalian Genomic DNA Miniprep Kit Protocol (Sigma-Aldrich). A genomic region of RIOK2 gene encompassing Ser483 was PCR-amplified from the genomic DNAs ...
-
bioRxiv - Bioengineering 2022Quote: ... 300 mM NaCl, 0.5 mg/mL sheared salmon sperm DNA [SSS DNA, ThermoFisher] and 0.5% dextran sulfate [Sigma]) for 30 min at room temperature ...
-
bioRxiv - Immunology 2021Quote: ... calcium-phosphate-DNA-particle were generated by mixing the plasmid DNA’s with a 250 mM CaCl (Sigma-Aldrich) solution which was then added dropwise to an equal volume of 2 x hepes buffered saline and subsequently incubated for 20 min at room temperature ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... total genomic DNA was isolated using the GenElute Plant Genomic DNA Miniprep kit (Sigma-Aldrich, St. Louis, MO) following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: Genomic DNA was isolated from CRISPR-edited and control cells using a GenElute Mammalian DNA Miniprep Kit (Sigma) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: DNA (0.5-1µg) was bisulfite treated using the two-step protocol of the Imprint DNA Modification Kit (Sigma). converted DNA was amplified using primers Fwd 5’ TTGATGGAGTAAAAGGAATTGTTTTAGG and Rev 5’ CCAATTCAAAAATTTAAAAAAAACAAAACC with HotStarTaq DNA Polymerase (QIAGEN) ...
-
bioRxiv - Bioengineering 2023Quote: ... Genomic DNA was extracted from ear slices with the GenElute Mammalian Genomic DNA Mini-prep Kit (Sigma-Aldrich). PCR was performed with PrimeSTAR® DNA Polymerase (Takara Bio ...