Labshake search
Citations for Millipore Sigma :
101 - 150 of 2130 citations for DNA Polymerase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... DNA fragments were amplified with Phusion High-Fidelity DNA Polymerase andorigo primers (Sigma–Aldrich, St. Louis, MO, USA). Then ...
-
bioRxiv - Developmental Biology 2020Quote: ... H2B was amplified using Q5 Hot Start High-Fidelity DNA Polymerase and then cloned into pPIDNB with QuikChange (Liu and Naismith, 2008) using KOD Xtreme Hot Start DNA Polymerase (Sigma, 71975-3). To generate pPIDNB2-DHB ...
-
bioRxiv - Neuroscience 2021Quote: ... R399Q and F101Y into dolphin Prestin using KOD DNA polymerase (71085 - EMD Millipore). All mutant and wild type constructs were confirmed by DNA sequencing prior to structural and electrophysiological experiments.
-
bioRxiv - Genetics 2019Quote: ... Three gBlock dsDNA templates were amplified with KOD HotStart DNA polymerase (EMD Millipore) using primers ErCas12af1/ErCas12aAr1 ...
-
bioRxiv - Bioengineering 2019Quote: PCR master mix: 1x KOD Xtreme Hot Start DNA Polymerase buffer (EMD Millipore), 1.2 µM (each ...
-
bioRxiv - Microbiology 2021Quote: ... The cDNA was amplified using KOD Xtreme Hot Start DNA Polymerase (Millipore Sigma). Specifically ...
-
bioRxiv - Microbiology 2021Quote: PCR reactions were carried out with either KOD Hot Start DNA Polymerase (Sigma) or iProof DNA Polymerase (Bio-Rad) ...
-
bioRxiv - Cell Biology 2020Quote: ... Conventional PCR was performed using KOD Xtreme Hot Start DNA Polymerase (EMD Millipore). The fragments were cloned into pCR-Blunt II TOPO using the Zero Blunt TOPO PCR Cloning Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2020Quote: ... Nectin-3 alpha was PCR amplified (KOD hot start DNA polymerase, Sigma-Aldrich) from a mouse brain cDNA library using the forward primer ...
-
bioRxiv - Cell Biology 2019Quote: ... PCR was performed using the KOD Hot Start DNA polymerase kit (Novagen, TOYOBO). The list of primers used for RT PCR is indicated on table 3.
-
bioRxiv - Microbiology 2019Quote: ... and 0.25 units JumpStart Taq DNA polymerase (Sigma-Aldrich, St. Louis, MO, USA). PCR primers 515F (GTGCCAGCMGCCGCGGTAA ...
-
bioRxiv - Biochemistry 2020Quote: All PCR reactions were carried out using KOD Hot Start DNA polymerase (Novagen). All RT-PCRs were carried out using Takara’s PrimeScript High Fidelity RT-PCR kit (R022A).
-
bioRxiv - Microbiology 2022Quote: ... and expression reporter plasmids were cloned using KOD Hot Start DNA Polymerase (Novagen). PCR and digestion products were purified using QIAquick PCR & Gel Cleanup kits (Qiagen) ...
-
bioRxiv - Biochemistry 2024Quote: ... PCR reactions were performed with KOD Hot Start DNA Polymerase (Sigma 71086-3) using a Mastercycler X50a (Eppendorf) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 1-3 units of Jump Start AccuTaq LA DNA polymerase mix (Sigma-Aldrich). Thermal cycles of amplification were carried out in a Personal Eppendorf Mastercycler (Eppendorf ...
-
bioRxiv - Molecular Biology 2020Quote: ... following the manufacturer’s instructions and using the JumpStart™ Taq DNA Polymerase (Sigma, #D9307).
-
bioRxiv - Synthetic Biology 2020Quote: ... All PCR reactions were carried out by KOD Hot Start DNA polymerase (Merck Millipore). PCR and Gel purification were done using Qiaquick nucleotide removal kit (qiagen ...
-
bioRxiv - Biochemistry 2021Quote: ... The cDNA was amplified using KOD Xtreme Hot Start DNA 396 Polymerase (Millipore Sigma) flanking the Spike encoding sequences ...
-
bioRxiv - Genetics 2023Quote: ... specific primers were designed and PCR was performed using KOD DNA polymerase (Sigma Aldrich). The amplification of DNA fragments was done following manufacturer’s instructions into a Bioer GeneExplorer thermal Cycler ...
-
bioRxiv - Developmental Biology 2019Quote: ... Repair templates and DNA fragments for cloning were generated by PCR amplification with either High Fidelity Hot Start KOD DNA Polymerase (Novagen) or Phusion Hot Start DNA Polymerase (Finnzymes) ...
-
bioRxiv - Microbiology 2023Quote: ... PCR reactions used to create DNA fragments for allelic exchange were performed using KOD Hot Start DNA Polymerase (EMD Millipore) and cloned into pLT06 (73) ...
-
bioRxiv - Genomics 2021Quote: ... An initial preamplification is conducted using extracted DNA with KOD Hot Start DNA Polymerase (71842-4, Millipore Sigma, Burlington, MA, USA) according to manufacturer’s instructions using all 5µL of extracted DNA in a total reaction volume of 20µL ...
-
bioRxiv - Plant Biology 2022Quote: The ARF10 gene sequence was amplified from genomic DNA using primers containing attb1 and attb2 sites (Table S4) using KOD Hot Start DNA Polymerase (Novagen™) and cloned into the donor vector ...
-
bioRxiv - Neuroscience 2022Quote: ... whole plasmids (Entry plasmids containing cmk-1 coding DNA sequences) were amplified with the KOD Hot Start DNA Polymerase (Novagen, Merck). Primers were phosphorylated in 5’ and were designed to contain the desired point mutation(s ...
-
bioRxiv - Molecular Biology 2019Quote: ... qPCR was performed on generated cDNA using Jump-Start Taq DNA Polymerase (D4184, Sigma-Aldrich), CFX96 Touch Real-Time PCR Detection System (BioRad ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The designed promoters were obtained by either PCR (KOD Hot-Start DNA polymerase, Merck-Millipore). PCR amplification was performed by KOD Hot Start DNA polymerase (Merck Millipore) ...
-
bioRxiv - Developmental Biology 2020Quote: The four lncRNAs tested were PCR-amplified with KOD Xtreme™ DNA Hotstart Polymerase (Millipore) from their 5’ end up until the last codon of the sORF to be tested ...
-
bioRxiv - Biochemistry 2022Quote: ... Captured products were amplified through PCR using KOD Xtreme Hot Start DNA Polymerase (EMD Millipore), cloned into the pET23-P2-D12A-THR expression backbone ...
-
bioRxiv - Molecular Biology 2022Quote: ... through ligation-independent cloning (LIC) using Novagen’s LIC-qualified T4 DNA polymerase (Sigma # 70099-M) as described by Q3 Macrolab (http://qb3.berkeley.edu/macrolab/) ...
-
bioRxiv - Biochemistry 2023Quote: ... through ligation-independent cloning (LIC) using Novagen’s LIC-qualified T4 DNA polymerase (Sigma # 70099-M) as described by Q3 Macrolab (http://qb3.berkeley.edu/macrolab/) ...
-
bioRxiv - Biochemistry 2023Quote: ... All PCR reactions were conducted using KAPA HiFi Hotstart DNA polymerase (Sigma-Aldrich, catalog #BK1000) unless stated otherwise ...
-
bioRxiv - Physiology 2023Quote: ... and PCR was performed using KOD Xtreme™ HotStart DNA Polymerase Kit (71975-3, Novagen) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... The real-time PCR analysis was also performed with the Complementary DNAs using JumpStart Taq DNA polymerase (Sigma-Aldrich, St. Louis, MO) and SYBR green nucleic acid stain (Molecular Probes ...
-
bioRxiv - Plant Biology 2020Quote: ... The coding sequence of LjSEN1 was amplified from nodule cDNA using DNA polymerase KOD (EMD Millipore). Primers are listed in Supporting Information Table S1 ...
-
bioRxiv - Neuroscience 2021Quote: ... DNA-free isolation was verified by PCR amplification (RedTaq® Polymerase, catalog no. D4309, Sigma-Aldrich). For this purpose ...
-
bioRxiv - Genomics 2021Quote: ... 15 units of Taq DNA polymerase were incubated with 200 nM of dATP dGTP dCTP (Sigma) and atto-532-dUTP (Jena Bioscience ...
-
bioRxiv - Biochemistry 2022Quote: ... Amplicons for deep sequencing were generated using KOD Xtreme™ Hot Start DNA Polymerase (EMD Millipore) following the manufacturer’s instructions in 50 μl reactions with 1 μL of the resuspended beads as template ...
-
bioRxiv - Molecular Biology 2023Quote: ... The Dbn1 mutant sequences were generated using the KOD Hot Start DNA Polymerase kit (Sigma-Aldrich), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Each 20 µl PCR reaction contained 10 µl of JumpStart RedTaq DNA Polymerase Master Mix (Sigma), 8 µl dH2O ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Splicing by overlap extension PCR was performed with the KOD Xtreme Hot Start DNA Polymerase (Novagen). Generally ...
-
bioRxiv - Cancer Biology 2023Quote: ... MyTaq reaction buffer and MyTaq DNA polymerase were pipetted together with 200 nM primer (Sigma Aldrich) pairs (gPCR_IGF2BP2-TESPA1_Bp_F 5’-CCT GCT TTG AGG AGG GGA GGG A-3’ & gPCR_IGF2BP2-TESPA1_Bp_R 5’-ACT GAG GAC AAT GCT ACG CAA GA-3’ ...
-
bioRxiv - Biochemistry 2020Quote: ... P4 5’ CTTGTCGTCATCGTCTTTGTAGTCCTTGTC 3’ and P5 5’ CAGGAAACA GCTATGACCATG 3’ and KOD Hot Start DNA Polymerase (Millipore).
-
bioRxiv - Microbiology 2020Quote: ... All PCR used for cloning were performed with high fidelity KOD Hot Start DNA Polymerase (EMD Millipore). E ...
-
bioRxiv - Molecular Biology 2020Quote: ... Libraries were PCR-amplified with 10-12 cycles using KOD Hot Start DNA polymerase (Millipore, 71086-3) and cleaned up using 1X KAPA Pure Beads ...
-
bioRxiv - Developmental Biology 2019Quote: ... 0.2 μM F and R primers and 0.5 U JumpStart™ Taq DNA Polymerase (Sigma Aldrich, D4184). Specific primers are listed in Table S2 ...
-
bioRxiv - Immunology 2021Quote: ... PCR reactions were carried out using FastStart™ High Fidelity DNA polymerase (Sigma-Aldrich Cat no. 3553400001) in a reaction volume of 250 μl using 10 μl of the cDNA product as a template ...
-
bioRxiv - Genetics 2023Quote: Extracted DNA was amplified using KOD Hot Start Polymerase (71086-4, Millipore Sigma, St. Louis, MO, USA) following manufacturer’s instructions with primers designed in the U6 region of the gRNA CCIV plasmid ...
-
bioRxiv - Molecular Biology 2023Quote: ... Libraries were PCR-amplified with 12-13 cycles using KOD Hot Start DNA polymerase (Millipore, 71086-3) and cleaned up using 1X KAPA Pure Beads.
-
bioRxiv - Plant Biology 2021Quote: Putative promoter sequences were amplified from genomic DNA using the KOD Hot start polymerase (#71086-5, Merck Millipore) and cloned into pJET1.2 (#K1231 ...
-
bioRxiv - Microbiology 2021Quote: ... The coding region was amplified from strain 86-028NP using primers Lav_bind-F (AGTCAGCATATGCAAGATAACTCACACGTTATCG) and Lav_bind-R (CTGACTGGATCCTTAGTGGCGGAAGCGTTGATATTG) with KOD HotStart proofreading DNA polymerase (Novagen) and cloned into the NdeI and BamHI sites of pET15b ...