Labshake search
Citations for Millipore Sigma :
51 - 100 of 2130 citations for DNA Polymerase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2020Quote: ... PCR was performed with KOD Hot Start DNA polymerase (Novagen) and oligonucleotides were synthesized by Sigma Aldrich ...
-
bioRxiv - Genomics 2019Quote: ... with 0.25 units of JumpStart Taq DNA Polymerase (Sigma Aldrich) in a total volume of 25 µl ...
-
bioRxiv - Microbiology 2021Quote: ... PCR reactions used either KOD Hot Start DNA Polymerase (Sigma) or iProof DNA Polymerase (Bio-Rad) ...
-
bioRxiv - Microbiology 2021Quote: ... and antibody-inactivated hot-start Taq DNA polymerase (Sigma-Aldrich). The amplified cDNA was purified with a GenElute PCR cleanup kit (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2021Quote: ... a PCR was performed with the KOD DNA polymerase (Novagen) to amplify the promoter and the resistance gene expression cassette with primers ML4154/ML4155 that also carry 30 bp homology with the 5 end of the TgNFS2 gene ...
-
bioRxiv - Microbiology 2021Quote: ... a PCR was performed with the KOD DNA polymerase (Novagen) to amplify the tag and the resistance gene expression cassette with primers ML5116/ML5117 (TgSDHB ...
-
bioRxiv - Microbiology 2021Quote: ... a PCR was performed with the KOD DNA polymerase (Novagen) to amplify the tag and the resistance gene expression cassette with primers ML3978/ML3979 (TgNFS2 ...
-
bioRxiv - Microbiology 2022Quote: ... a PCR was performed with the KOD DNA polymerase (Novagen) to amplify the promoter and the resistance gene expression cassette with primers ML4107/ML4108 that also carry 30□bp homology with the 5□ end of the TgSUFC gene ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Taq DNA polymerase and PCR buffers were purchased from Sigma, India ...
-
bioRxiv - Cell Biology 2020Quote: The DNA polymerase inhibitor aphidicolin (Cat. No. A0781, Sigma-Aldrich) was added with indicated concentrations at specified time point from day 15 to day 27 or as shown in Figures ...
-
bioRxiv - Plant Biology 2021Quote: ... with PCR reactions using FastStart Taq DNA Polymerase (Sigma-Aldrich), which does not have proofreading activity ...
-
bioRxiv - Microbiology 2022Quote: ... a PCR was performed with the KOD DNA polymerase (Novagen) to amplify the tag and the resistance gene expression cassette with primers ML3980/ML3981 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.25 U of KOD hot start DNA polymerase (Millipore Sigma) and nuclease free water ...
-
bioRxiv - Microbiology 2023Quote: ... 1X KOD Hot Start DNA Polymerase Buffer (Novagen, Cat#: 71155), 1.5 μM MgSO4 (Novagen Cat# ...
-
bioRxiv - Molecular Biology 2022Quote: ... and amplified by the KAPA LongRange DNA polymerase (Sigma, KK3502) using the universal forward primer ...
-
bioRxiv - Microbiology 2020Quote: ... Integrated viral DNA was quantified by first pre-amplifying the DNA using AccuTaq™ LA DNA Polymerase (Sigma) using the following primers ...
-
bioRxiv - Microbiology 2022Quote: ... Each DNA fragment was amplified with KOD Xtreme Hot Start DNA polymerase (Millipore,Burlington, MA) using cDNA from SARS-CoV-2/human/USA/WA-CDC-WA1/2020 and contains 80 bp of homology to its adjacent fragments for assembly ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and amplification of A33 cDNA by Taq DNA Polymerase (Sigma-Aldrich). The extracellular domains of the antigen were PCR amplified ...
-
bioRxiv - Bioengineering 2019Quote: ... 0.02 U/µL KOD Xtreme Hot Start DNA Polymerase (EMD Millipore).
-
bioRxiv - Genetics 2022Quote: ... The PCR was performed with Thermococcus kodakaraenis (KOD) DNA polymerase (Novagen).
-
bioRxiv - Immunology 2020Quote: ... All PCR products were amplified using KOD DNA polymerase (EMD Millipore) and purified by gel extraction (Clontech Libraries).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Transcripts were amplified using FastStart Taq DNA Polymerase Kit (Millipore Sigma) using primers (S4 File) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... QuikChange was used (with KOD Hot Start DNA Polymerase (Sigma-Aldrich)) to perform site directed mutagenesis on the two lysine residues on a plasmid backbone first before it was amplified and inserted into the pdu operon ...
-
bioRxiv - Microbiology 2023Quote: ... PCRs were done using the JumpStart Taq DNA polymerase (Sigma-Aldrich). Primer pairs were used to amplify by PCR flanking regions of approximately 500 bp downstream and upstream of the target genes using the appropriate genomic DNA as a template ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 1 μl of KOD Xtreme Hot Start DNA Polymerase (Sigma 71975), 25 μl of Xtreme buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... MCIDAS-NotI-R- TTGCGGCCGCCTAACTGGGGACCCAGCGGAACT) using KOD Hot Start DNA Polymerase (Millipore) and cycling conditions recommended from the manufacturer (polymerase activation at 95 °C for 2 min ...
-
bioRxiv - Genomics 2023Quote: ... All PCRs were performed using KOD Hot Start DNA polymerase (Novagen) according to (46) ...
-
bioRxiv - Genomics 2023Quote: ... PCR was performed using JumpStart Taq DNA Polymerase (Sigma-Aldrich, D9307) with the following PCR conditions ...
-
bioRxiv - Genetics 2019Quote: ... Minigenes were constructed by DNA assembly of PCR fragments that were amplified from HEK293T genomic DNA using KOD Hot Start DNA polymerase (Novagen). For the wild-type minigene ...
-
bioRxiv - Genetics 2019Quote: ... PCR reactions were performed using the DNA polymerase Phusion (lab preparation) for short fragments (< 5 kb) or KOD Xtreme Hot Start polymerase (Novagen) for longer fragments (>5 kb) ...
-
bioRxiv - Microbiology 2023Quote: ... The polymerase chain reaction (PCR) was run using 0.2 U/μL of KOD Hot Start DNA polymerase (Novagen, Cat# 71316), 0.3 μM each of primers ...
-
bioRxiv - Physiology 2022Quote: ... 2.5 μl of DNA template and 0.625 units JumpStart Taq DNA polymerase (Sigma-Aldrich, St. Louis, MO). PCR primers targeted a portion of the small-subunit (ITS-1507F,GGTGAAGTCGTAACAAGGTA ...
-
bioRxiv - Synthetic Biology 2021Quote: ... PCR amplifications were performed using KOD Hot Start DNA polymerase (Merck Millipore). All restriction enzymes ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... For the PCRs we used a standard Taq DNA polymerase (Sigma Aldrich) and limited the elongation time to 90 seconds so that an homozygous insertion of the 5-kb ONSEN TE or the T-DNA would prevent the formation of a PCR-product ...
-
bioRxiv - Genetics 2020Quote: ... 0.5 U DNA recombinant Taq polymerase in buffer (pH= 8.0; Sigma, Germany), 1x PCR buffer (pH=8.7 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... PCR amplification was performed by KOD Hot Start DNA polymerase (Merck Millipore). All enzymes ...
-
bioRxiv - Microbiology 2021Quote: ... PCR was performed using KOD Hot Start DNA polymerase (Millipore 71842-3) using primers KL207/KL200 for the sfgfp gene and primers BAC338F/BAC805R for the 16S rRNA gene48.
-
bioRxiv - Microbiology 2020Quote: ... All PCRs were performed using KOD Hot Start DNA polymerase (Novagen®), following standard protocols ...
-
bioRxiv - Molecular Biology 2020Quote: ... A PCR with REDTaq® DNA polymerase (Sigma-Aldrich, Saint Louis, Missouri) was performed and the length of the amplified products was checked by 1% agarose gel electrophoresis ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... KOD Hot-Start DNA Polymerase was obtained from Novagen (Merck, Darmstadt, Germany). Restriction enzyme DpnI was bought from New England Biolabs (Ipswich ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR amplification using KOD Xtreme™ Hot Start DNA Polymerase (Millipore, 71975) and the primers TCGATGCTCTGTTTCGAATG and CTTCTTCCCCCTTGCCTTAC flanking the targeted deletion site ...
-
bioRxiv - Molecular Biology 2022Quote: ... The PCR was performed using KOD Hot start DNA polymerase (Millipore Sigma) since it has a low error rate unlike Taq polymerase (Engler and Marillonnet 2013) ...
-
bioRxiv - Molecular Biology 2023Quote: ... All PCRs were performed using KOD Hot Start DNA polymerase (EMD Millipore) according to the manufacturer’s instructions.
-
bioRxiv - Synthetic Biology 2023Quote: ... PCR reactions were performed using the KOD Hotstart DNA polymerase (Merck Millipore). Plasmid isolation ...
-
bioRxiv - Plant Biology 2023Quote: ... Amplification of targeted regions performed by JumpStart™ Taq DNA Polymerase (Sigma). The PCR products were deep sequenced in paired end mode (100 bp ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR mixture consisted of MTP Taq DNA Polymerase (Sigma-Aldrich, Germany) (0.05 u/μL ...
-
bioRxiv - Plant Biology 2023Quote: ... All PCRs were performed using KOD Hot Start DNA Polymerase (EMD Millipore). In the via-1 strain ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR reaction contained 1.25 U JumpStartTM Taq DNA Polymerase (Sigma-Aldrich), 1× PCR Buffer (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2023Quote: ... and 2.5 U of the MTP Taq DNA polymerase (Sigma-Aldrich, USA). The amplification was carried out using the following program ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... We used a high fidelity Taq DNA polymerase for DNA amplification (Expand High Fidelity PCR system from Sigma). After that ...