Labshake search
Citations for Millipore Sigma :
1851 - 1900 of 10000+ citations for 6 7 Dichloro 1H indole 2 3 dione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) was used for cell viability (Sigma, Israel).
-
bioRxiv - Biophysics 2021Quote: ... The bottom coverslip was functionalized with an amino-group in the 2% 3-aminopropyltheithoxysilane (440140, Sigma) in acetone for 10 min ...
-
bioRxiv - Biochemistry 2020Quote: ... The sequence of the biotinylated 2’-deoxyoligonucleotide is 5’ – (Biotin) AAATGGTGCCGAAACCCGGGATCGAACCAGGGT – 3’ (Sigma Aldrich, Munich, Germany)
-
bioRxiv - Neuroscience 2021Quote: ... Amigo2-icreER;ROSA-TdTomato mice were given 2 or 3 daily intraperitoneal injections of tamoxifen (Sigma T5648 ...
-
bioRxiv - Neuroscience 2019Quote: ... embedded with sucrose 30% for 3 days and finally frozen in 2-methylbutane (Sigma-Aldrich, France) at −80°C ...
-
bioRxiv - Cell Biology 2021Quote: ... and washed 3 times in 1x PBS and 2 times in 2x SSC buffer (Sigma-Aldrich) for five min each ...
-
bioRxiv - Neuroscience 2021Quote: ... frozen VMH (from 2 – 3 mice) was homogenized in Lysis Buffer (EZ Prep Nuclei Kit, Sigma) with Protector RNAase Inhibitor (Sigma ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cell viability was evaluated by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Sigma) assay as described previously(Lv et al ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cells were next incubated with 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (Sigma-Aldrich M5655) for 4h followed by formazan crystal solubilization with isopropanol and absorbance readings at OD570 (Kumar et al. ...
-
bioRxiv - Immunology 2020Quote: ... 2-3 × 105 cells/well were plated in an ELI Spot plate (MAHAS4510, Merck Millipore, USA) and in vitro cultured for 18-24 hours in media supplemented with or without peptide at 0.5 µM (or ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Cytotoxicity was determined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma-Aldrich) assays ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cell viability was evaluated by adding MTT 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (Sigma) to the cells for 4 h and OD562 measurements according to the manufacturer’s protocols (Sigma).
-
bioRxiv - Bioengineering 2020Quote: ... and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) were purchased from Sigma-Aldrich. Glutaraldehyde (50% w/w ...
-
bioRxiv - Genetics 2019Quote: BzATP (2′(3′)-O-(4-Benzoylbenzoyl) adenosine 5′-triphosphate triethylammonium salt) was purchased from Millipore Sigma and ...
-
bioRxiv - Neuroscience 2020Quote: SNAP-5114 (1-[2-[tris(4-methoxyphenyl)methoxy]ethyl]-(S)-3-piperidinecarboxylic acid) from Sigma-Aldrich
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 10 mM Sodium butyrate supplemented with 25 μl Phosphatase Inhibitor Cocktail 2&3 (P5726&P0044, Sigma) and 1 tablet of proteinase inhibitor cocktail (A32963 ...
-
bioRxiv - Microbiology 2020Quote: ... phenylethanol and 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (MTT) were obtained from Sigma-Aldrich.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and phosphatase inhibitor cocktails 2 and 3 were obtained from Sigma-Aldrich (St. Louis, MO, USA). The secondary fluorescent antibody Alexa Fluor 488 (goat anti-mouse ...
-
bioRxiv - Molecular Biology 2022Quote: The 3-(4,5-dimethylthiazol-2-ul)-2,5-diphenyl tetrasodium bromide (MTT, Sigma-Aldrich, St. Louis, MO) cytotoxicity assay measures mitochondrial reductases ...
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Neuroscience 2022Quote: ... Selection was initiated after 2-3 days with 25-150μg/ml of Hygromycin B (Sigma-Aldrich) and maintained for 10-15 days ...
-
bioRxiv - Molecular Biology 2023Quote: ... coverslips were incubated for 3 hours in 100 μl of 2% acrylamide (AA; A4058, Sigma-Aldrich) + 1.4% formaldehyde (FA ...
-
bioRxiv - Microbiology 2023Quote: ... and tissues digested in 3 mL complete HBSS-2 containing 0.5 mg/mL Collagenase-D (Sigma) at 37°C for 30 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... and 2-heptyl-3-hydroxy-4-quinolone (PQS) were obtained from Sigma Aldrich (St. Louis, MO). Triton X-100 and Tween-20 were used at 0.2% and 2% ...
-
bioRxiv - Cancer Biology 2023Quote: Cellular proliferation was determined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium (MTT; Sigma) assay and validated by viable cell counts.80
-
bioRxiv - Cancer Biology 2022Quote: ... cell viability was assessed using MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide) (Sigma-Aldrich). 10μl MTT (5 mg/ml ...
-
bioRxiv - Developmental Biology 2023Quote: ... predicted mature peptide regions of ZmRALF1/2/3/5 genes were cloned into plasmid pET32b (Novagen) with gene specific primers as indicated (Supplemental Table S1) ...
-
bioRxiv - Bioengineering 2022Quote: ... USA) and subsequently submerged in a solution of 2% bis[3-(trimethoxysilyl)propyl]amine (Sigma-Aldrich), and 1% DI-water in IPA at 80°C for 20 minutes following previously published protocols 67 ...
-
bioRxiv - Bioengineering 2023Quote: ... MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium) reagent and paraformaldehyde were purchased from Sigma-Aldrich, USA ...
-
bioRxiv - Neuroscience 2023Quote: ... 0,005 CPP [()-3-(2-carboxypiperazin-4-yl)propyl-1-phosphonic acid] (NMDA receptors antagonist, Sigma Aldrich). Traces of whole-cell voltage-clamp recordings (holding potential ...
-
bioRxiv - Microbiology 2023Quote: ... LDH buffer contained: 3 µl of “INT” solution containing 2 mg/ml tetrazolium salt (Sigma I8377) in PBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3-(4,5 dimethylthiazol-2-tl)-2,3-diphenyltetrazolium bromide (MTT) was purchased from Sigma-Aldrich (STL, USA). Bovine serum albumin (BSA ...
-
bioRxiv - Microbiology 2024Quote: ... 3-(2pyridyl)-5,6-bis(2-(5-furylsulfonic acid))-1,2,4-triazin (Sigma-Aldrich, St Louis, MO, USA) (27) ...
-
bioRxiv - Cancer Biology 2024Quote: ... LDH buffer contained: 3 µl of “INT” solution containing 2 mg/ml tetrazolium salt (Sigma I8377) in PBS ...
-
bioRxiv - Bioengineering 2024Quote: ... Phalloidin and MTT [3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) were purchased from Sigma Aldrich. DMEM (Dulbecco’s Modified Eagle’s Medium) ...
-
bioRxiv - Bioengineering 2024Quote: ... supplemented with 0.5 mg/mL 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT, Sigma, USA) for 4 hrs at 37°C ...
-
bioRxiv - Biophysics 2023Quote: Photodynamic effect of MB-loaded nanoMOFs and other formulations was measured using 2’,7’-dichlorofluorescin diacetate (H2DCF-DA) (Sigma-Aldrich, St Louis, MO), which converts upon ROS generation into fluorescent oxidation product ...
-
bioRxiv - Cell Biology 2020Quote: ... 400,000 cells were plated in 6-well poly (2-hydroxyethyl methacrylate) (poly-HEMA, Sigma-Aldrich, St. Louis, MO, USA)-coated plates for the indicated amount of time in the figure legends ...
-
bioRxiv - Cell Biology 2020Quote: ... Following staining with secondary antibodies and 0.1 µg/ml 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI, Sigma, D-9542) diluted in 5% NGS-PBS ...
-
bioRxiv - Neuroscience 2020Quote: ... Each IHC staining round was accompanied by nuclear cell counterstaining with 4’,6-diamidino-2-phenylindole (1μg/ml DAPI (Sigma) diluted 1:1000 in PBS) ...
-
bioRxiv - Cell Biology 2022Quote: ... Actin was visualized by FluoProbes 547H (557/572nm) coupled Phalloïdin (Interchim) and nuclei with 0.2 μg/mL 4’,6-diamidino-2-phenylindole (DAPI; Sigma-Aldrich). Coverslips were mounted in Mowiol (Sigma-Aldrich).
-
bioRxiv - Cell Biology 2022Quote: ... the nucleus was stained by incubation with 4’,6-diamidino-2-phentylindole (DAPI, Sigma, 200 ng/ml in PBS) for 1 min at RT ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Embryos were washed in TBS stained with 4’,6-diamidino-2-phenylindole (DAPI) (1:1000, REF-D9542, Sigma, USA) for 30 min at RT ...
-
bioRxiv - Immunology 2019Quote: ... spleens from C57BL/6 mice were cut to smaller pieces and digested with Collagenase D (2 mg/ml, Sigma) For 30 min at 37°C ...
-
bioRxiv - Immunology 2019Quote: ... diluted 1:150 in washing buffer (45 min) and 4’,6-diamidino-2-phenylindole counterstain (DAPI; Roche/Sigma-Aldrich) diluted 1:250 in TBS (15 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... mice were fasted for 6 hours prior to IP injection of 2 g/kg 20% D-glucose (Sigma-Aldrich) in water with a 26G needle ...
-
bioRxiv - Immunology 2021Quote: ... Nuclei were then counterstained with 4′,6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich, catalog no. D9542, 100 ng/ml). The stained tissue sections were scanned using an Olympus VS-120 slide scanner and imaged using a Hamamatsu ORCA-R2 C10600 digital camera for all bright-field and fluorescent images ...
-
bioRxiv - Cell Biology 2020Quote: ... The fixed animals were then washed twice with PBSTx1 and stained with 1μg/mL DAPI (4’,6-diamidino-2-phenylindole)(Sigma) solution for 30 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were washed five times and stained with 4',6-Diamidino-2-phenylindole (DAPI) (Sigma, Cat No. 10236276001, Germany) for 20 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... cells were then spun down (2 min with 1000 rpm) and resuspended in 6 ml serum-free medium (Sigma Cat# ...