Labshake search
Citations for Millipore Sigma :
1651 - 1700 of 10000+ citations for 2' Methyl 3 phenylpropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... cholera toxin B subunit (CtxB)-FITC conjugate (C1655), methyl-β-cyclodextrin (Mβ-CD, C4555) and chlorpromazine hydrochloride (CPZ, C8138) were procured from Sigma.
-
bioRxiv - Cancer Biology 2020Quote: ... Each spheroid was made by resuspending 8,000 cells in 15 μl media with 0.24% methyl cellulose (4,000 cpi, Sigma-Aldrich, St. Louis, MO) by the hanging drop method 34 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the leaves from five-week-old Col-0 plants were sprayed 6 times over 48 h with methyl jasmonate (MeJA) (Sigma-Aldrich, Cat # 392707 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Nuclei were fluorescently labeled using methyl green (Prieto et al, 2014) and actin filaments with TRITC-conjugated phalloidin (Sigma-Aldrich, P1951). Observation of whole embryos was performed using a Zeiss LSM 880 or a Zeiss LSM 800 laser confocal microscope ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were allowed to grow for 96 h in drug containing medium (methyl methanesulfonate, Acros Organics 156890250, mitomycin C, Sigma M4287, 4-nitroquinoline 1-oxide, Sigma N8141 ...
-
bioRxiv - Immunology 2021Quote: ... overnight under gentle agitation at 4°C and eluted with lectin elution buffer containing 1 M Methyl a-D-mannopyranoside (M6882, Millipore Sigma). The resulting solution was dialyzed in PBS and further purified by size exclusion chromatography using Sephacryl S-500 HR resin.
-
bioRxiv - Developmental Biology 2020Quote: ... Gentle pressure was applied to epididymis tissue using forceps and sperm were allowed to swim out during a 45-minute incubation in HTF + 0.75mM methyl-β-cyclodextrin (Millipore MR-070-D, Sigma C4555) at 37°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... LMPs were cultured in this cholesterol-free medium for 20 t0 24 hrs and then treated with 10mM methyl-β-cyclodextrin (MβCD, Sigma C4555) for 15min at 37°C to remove cholesterol from plasma membranes ...
-
bioRxiv - Systems Biology 2020Quote: ... TBDMS (N-methyl-N-(t-butyldimethylsilyl) trifluoroacetamide + 1% t-butyl-dimethylchlorosilane) and MSTFA (N-methyl-N-(trimethylsilyl) trifluroacetamide) were also purchased from Sigma-Aldrich. Media components and other reagents were purchased from Himedia and Sigma-Aldrich.
-
bioRxiv - Cell Biology 2021Quote: ... 100 nM of the specified SPR2-GFP proteins along with 2.5 μM 1:9 rhodamine-labeled porcine tubulin were then introduced into the flow chamber in BRB80 buffer containing 1% methyl cellulose (4000 cP, Sigma-Aldrin), 50 mM DTT and an oxygen-scavenging system consisting of 250 μg/ml glucose oxidase ...
-
bioRxiv - Cell Biology 2021Quote: ... Microtubule polymerization was initiated by flowing in 20 mM 1:25 rhodamine-labeled porcine tubulin in BRB80 buffer containing 1% methyl cellulose (4000 cP, Sigma-Aldrich), 50 mM DTT ...
-
bioRxiv - Physiology 2021Quote: ... female C57BL/6J mice (age 10-11 weeks) were given 2mg/ml IDO1 inhibitor (1-methyl-L-tryptopham, L1MT; Sigma-Aldrich) in drinking water supplemented with Splenda sweetener (2 sachets/liter ...
-
bioRxiv - Plant Biology 2021Quote: ... tomato leaflets from the 3rd leaf were detached and immediately dipped for 10 sec in a 50 μM or 100 μM methyl-jasmonate (MeJA; Sigma-Aldrich) or mock solution (0.1 % EtOH ...
-
bioRxiv - Bioengineering 2021Quote: ... with the control and labeling diets containing regular L-methionine (Met) and methyl-13C-L-methionine (13C-Met, 99%, Sigma-Aldrich), respectively (i.e. ...
-
bioRxiv - Plant Biology 2021Quote: ... were permethylated by two rounds of treatment with sodium hydroxide (15 minutes each) and methyl iodide (45 minutes each) in DMSO (Sigma, USA) (46) ...
-
bioRxiv - Physiology 2022Quote: ... 70 animals were placed onto each 50 mm tight-lidded petri plate with modified NGM containing 40 mM paraquat (or methyl viologen dichloride, from Sigma-Aldrich), 51 μM FUdR ...
-
bioRxiv - Physiology 2022Quote: ... young adult animals were transferred to 1 mM auxin plates supplemented with 20 mM paraquat (Methyl viologen dichloride hydrate, Sigma-Aldrich). Animals were scored as in lifespan assays but twice a day ...
-
bioRxiv - Physiology 2021Quote: ... animals were transferred at a density of 70 worms per plate to 50 mm tight-lidded plates with modified NGM containing 40 mM paraquat (or methyl viologen dichloride, from Sigma-Aldrich), 51 μM FUdR ...
-
bioRxiv - Immunology 2020Quote: ... cells were treated for 1 h with a range of concentrations of the DNA methylating agent methyl methanesulfonate (MMS) (Sigma-Aldrich), and subsequently cultured for an additional 48 h ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were collected at various timepoints and the reaction was terminated by addition of SDS-PAGE sample buffer containing 100 mM methyl methanethiosulfonate (MMTS) (Sigma Aldrich). The PEGylation reaction samples were analysed using non-reducing polyacrylamide gels ...
-
The gut hormone Allatostatin C regulates food intake and metabolic homeostasis under nutrient stressbioRxiv - Physiology 2020Quote: ... supplemented with 1 mL/L propionic acid and 1 g/L methyl-4-hydroxybenzoate) containing 0.5% erioglaucine dye (Sigma-Aldrich, #861146) and allowed to feed for 30 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... solutions of PVDF-TrFE (70/30) (400 kDa., PDI of 2.1, Solvay Solexis, Inc., Thorofare, NJ) in methyl ethyl ketone (MEK; Sigma-Aldrich, Inc.) was loaded into a syringe with an 18-gauge needle ...
-
bioRxiv - Systems Biology 2023Quote: ... followed by an incubation at 40°C for 1 h and then adding 70 μl of MSTFA (N methyl-N-trimethylsilyltrifluoroacetamide; Sigma-Aldrich) followed by another incubation at 40°C for 2 h ...
-
bioRxiv - Developmental Biology 2023Quote: ... and the remaining un-labelled EdU sites were then saturated by click-it chemistry with an excess of non-fluorescent azide (Azido-methyl-phenyl-sulfide 95%, Sigma, #244546): the reaction was prepared and achieved according to the manufacturer’s recommendations except the standard fluorescent azide was replaced by the non-fluorescent one at a final concentration of 2mM ...
-
bioRxiv - Biochemistry 2024Quote: The cationic porphyrin derivative 5,10,15,20-tetrakis (1-methyl-4-pyridinio) porphyrin tetra (p-toluenesulfonate) (TMPyP4) was obtained from Sigma-Aldrich (catalog no. 613560). The synthetic acridine analogue BRACO-19 was obtained from Sigma-Aldrich (catalog no ...
-
bioRxiv - Bioengineering 2024Quote: ... as inhibitor), and poly(ethylene glycol) methyl ether methacrylate (MEMA-PEG, 950 g/mol, MEHQ as inhibitor) are purchased from Sigma Aldrich and purified by recrystallizing in acetone to remove inhibitors ...
-
bioRxiv - Immunology 2024Quote: ... the trypsin was used as is and the pepsin one was labeled at the C-terminal end using Arginine methyl ester dihydrochloride (Sigma-Aldrich) using the method used in (36).
-
bioRxiv - Microbiology 2024Quote: ... In-cell SHAPE modifications were made by adding fresh 500µl of 100mM 1-Methyl-7-nitroisatoic anhydride (1M7) (Sigma-Aldrich, 908401) in DMSO to 4.5ml pre-warmed culture media to the dish and incubated for 3min at 37C ...
-
bioRxiv - Cell Biology 2024Quote: ... Inhibition of NO in cell system was achieved by treating the cells with Nω-Nitro-L-arginine methyl ester hydrochloride (L-NAME, (1 mM) (#N5751; Sigma Aldrich) which is an analog of arginine ...
-
bioRxiv - Microbiology 2023Quote: ... The normal group was intraperitoneally administered a dose of 8 mL/kg of 0.5% carboxy methyl cellulose (Sigma-Aldrich, MO, USA) as an excipient ...
-
bioRxiv - Biochemistry 2023Quote: ... Poly(methyl methacrylate-co-methacrylic acid) (85:15 monomer ratio) (Cat. No. 376914) (hereafter, referred to as acrylic copolymer (ACP)) (Sigma, USA) was purchased ...
-
bioRxiv - Cancer Biology 2022Quote: ... mice were randomized and treated with 25 mg/kg Crizotinib or the corresponding dose of vehicle (hydroxypropyl methyl cellulose, Sigma Aldrich) (oral gavage ...
-
bioRxiv - Plant Biology 2023Quote: ... The samples were derivatized for GC-MS analysis by adding 10 μL of pyridine and 50 μL of N-Methyl-N-(trimethylsilyl)trifluoroacetamide (Sigma-Aldrich) to the residue ...
-
bioRxiv - Biochemistry 2023Quote: ... 100 ul of reaction was passed over a Dowex cation exchange resin column (N-methyl D-glucamine form) (217484; Millipore-Sigma) to remove any uninternalized 14C-lysine ...
-
bioRxiv - Cancer Biology 2023Quote: ... Nω-Nitro-L-arginine (L-NNA) (Catalog # N5501) and Nω-Nitro-L-arginine methyl ester hydrochloride (L-NAME) (Catalog # N5751) were both obtained from Millipore Sigma and solubilized in 1M HCL and dH2O ...
-
bioRxiv - Biochemistry 2023Quote: ... Avicel PH-101, NAD+, NADP+, ATP, MgCl2, cellobiose, 1-Methoxy-5-methylphenazinium methyl sulfate (mPMS, ref M8640) were purchased from Sigma Aldrich. Xylobiose (O-XBI) ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.15 ml per 10 g body weight) and perfused with ice-cold dissection solution containing (in mM): 93 N-Methyl-D-glucamine (cat#M2004, Sigma-aldrich), 2.5 KCl (cat#P3911 ...
-
bioRxiv - Cancer Biology 2024Quote: Cells were seeded in a 96-well plate at a density of 15,000 cells per well in 50 µL of medium containing the HDAC substrate N-(4-Methyl-7-aminocoumarinyl)-Nα-(t-butoxycarbonyl)-Nω-acetyllysineamide (21 μM, MAL, Sigma-Aldrich) and incubated for 8 h at 37 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... islets isolated from chow-fed C57BL/6 WT mice were pre-incubated in 20 mM cholesterol loaded onto methyl-β-cyclodextrin (MβCD) (C4951, Sigma Aldrich) diluted in 1X Krebs-Ringer bicarbonate-Hepes (KRBH ...
-
bioRxiv - Genomics 2024Quote: ... The samples were further trimethylsylilated for 30 minutes at 37°C with 70 µL N-Methyl-N-(trimethylsilyl) trifluoroacetamide (Millipore Sigma). A fatty acid methyl ester mixture was added to the trimethylsylilation solution for retention time calibration ...
-
bioRxiv - Biochemistry 2024Quote: ... Post-exposure baking at 95 °C for 5 min was then followed by developing with propylene glycol methyl ether acetate (PGMEA, Sigma-Aldrich) and a washing step with isopropanol (IPA ...
-
bioRxiv - Developmental Biology 2024Quote: ... MsA were pre-incubated with the endothelial nitric oxide synthase inhibitor L-NG-nitroarginine methyl ester (L-NAME, 10 µM; Sigma-Aldrich) or L-NAME (10 µM ...
-
bioRxiv - Immunology 2020Quote: ... two STAT-3 inhibitors (STAT-3 inhibitor III (WP-1066) and STAT-3 inhibitor XIII (C-188-9) were tested (Merck, Sigma) and WP-1066 was used for infection studies at a final concentration of 12 μM ...
-
bioRxiv - Plant Biology 2020Quote: ... inflorescences were soaked in 3% (w/v) 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (Sigma Chemical, St. Louis, MO, USA, E6383) with 0.05% (v/v ...
-
bioRxiv - Neuroscience 2024Quote: ... antibodies were diluted in a 3% BSA in PBS and either 3% normal goat serum or 3% normal donkey serum (Millipore-Sigma) depending on the secondary antibody host species ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... For autophagy inhibitors treatment, 3-methyladenine (3-MA, 5 mM) (Sigma-Aldrich), bafilomycin A1(Baf ...
-
bioRxiv - Cell Biology 2020Quote: ... 14-3-3 antibody and active recombinant AMPK (α2β1γ1) were from Millipore. Precast Tris-Glycine polyacrylamide gels and 10X tris-glycine gel electrophoresis buffer were from BioRad ...
-
bioRxiv - Bioengineering 2021Quote: ... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC-HCl, Sigma Aldrich, 8510070025), chlorosulfonic acid (Sigma 571024) ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Chk1 (3’Chk1) (5’CUGGUGAAUAUAGUGCUGCUA3’ from Sigma-Aldrich), Polι (SMART pool ...
-
bioRxiv - Plant Biology 2022Quote: ... in the presence of 1 mM 3-aminotriazol (3-AT) (Sigma-Aldrich). Results were expressed in the form of a heat map for the strength of interaction according to the colony growth after five days of incubation at 30°C.