Labshake search
Citations for Millipore Sigma :
1501 - 1550 of 10000+ citations for 6 Chloro 7H pyrrolo 2 3 d pyrimidine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Nuclei were labeled using 4′,6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich, catalog no. D9542, 100 ng/ml). The immunostained lymph node tissues were scanned using an Olympus VS-120 slide scanner with a Hamamatsu ORCA-R2 C10600 digital camera ...
-
bioRxiv - Microbiology 2023Quote: ... NR-6226C (Terpyridine (2,2′:6′,2′′-Terpyridine, 98%)) was purchased from Sigma Aldrich (now Merck, KGaA, Darmstadt Germany). Metal solutions containing 2 µM ...
-
bioRxiv - Molecular Biology 2023Quote: ... and incubated in blocking buffer containing 0.8 μg/ml DAPI (4’,6-diamidino-2-phenylindole, Sigma, cat # D9542) for 1 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... nuclei were stained with 4ʹ,6-diamidino-2-phenylindole (DAPI) and mounted in Mowiol (Sigma-Aldrich, MO, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The plate was then rinsed with PBS and counter-stained with 4′,6-diamidino-2-phenylindole DAPI (Sigma) for 15 min ...
-
bioRxiv - Bioengineering 2023Quote: ... Sections were incubated with DAPI (4’,6-Diamidino-2-phenylindole dihydrochlorid) solution(D9542, Sigma-Aldrich, diluted 1:10000) for 7 minutes at RT and subsequently mounted in ProLong Gold Antifade mounting medium (cat ...
-
bioRxiv - Genetics 2023Quote: ... were used as secondary antibodies and sections were counterstained with 4′,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich). Mounting was performed using Prolong Gold Antifade Mountant (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... Enriched proteins were denatured in U/T buffer (6 M urea, 2 M thiourea, 1 mM DTT (Sigma), 10 mM HEPES ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cells were routinely passaged in a 1:6 ratio every 2 days using 1× Trypsin–EDTA solution (Sigma) at 37°C and the reaction was stopped using 10% fetal bovine serum (FBS ...
-
bioRxiv - Developmental Biology 2023Quote: ... Samples were then incubated in the DNA fluorescent stain DAPI (4’,6-diamidino-2-phenylindole; Sigma-Aldrich, D9542) at a concentration of 1 µg/ml in 1x PBS for 30 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.04 mg/ml catalase (EMD biosciences) and 1 mM 6-hydroxy-2,5,7,8-tetramethyl-chromane-2-carboxylic acid (Trolox) (Sigma Aldrich). After DNA was tethered on the surface ...
-
bioRxiv - Microbiology 2024Quote: ... The cells were washed and the nuclei counter stained with 40-6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich) for 20 min ...
-
bioRxiv - Neuroscience 2024Quote: ... were used as secondary antibodies and sections were counterstained with 4′,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich). Mounting was performed using Prolong Gold Antifade Mountant (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI) 1:1,000 (Sigma-Aldrich Sweden AB, Stockholm, Sweden). Invasion of the cells was measured by counting the nuclei of the cells that migrated through the filter pores towards the chemoattractant (6% FBS) ...
-
bioRxiv - Cell Biology 2022Quote: ... 120 ul of the gel solution were poured into the center of an activated glass bottom dish and covered with 22*22 mm coverglass previously chloro-silanated with DCDMS (Dichlorodimethylsilane, Sigma-Aldrich, USA). Then ...
-
bioRxiv - Microbiology 2021Quote: ... individuals were placed in a microtube containing in 100 µl of either Schneider’s media (Experimental Replicates 1 and 2) or RPMI media (Experimental Replicates 3 and 4) to which 2% Penicillin/Streptomycin and Amphotericin B (Sigma-Aldrich, Dorset, UK) had been added ...
-
bioRxiv - Zoology 2020Quote: ... 3-methyl-but-2-enyl acetate and (2E)-hex-2-enyl acetate were confirmed with analytical standards from Sigma-Aldrich (St. Louis, MO). For the analysis of CHCs ...
-
bioRxiv - Microbiology 2022Quote: ... diluted in DMSO and 6-Thioguanine (6-TG) (Sigma-Aldrich) diluted in 1M NaOH ...
-
bioRxiv - Biochemistry 2020Quote: ... and glucose-6-phosphate dehydrogenase (G-6-PDH; Sigma-Aldrich). For enhanced chemiluminescence detection (ECL) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Dextran T-500 (Sigma-Aldrich; 6 mL, 6% in saline) was added to the cells and filled up to 50 mL with 0.9% saline ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mg/mL 6-animopenicillanic acid (6-APA) (Sigma-Aldrich), 5 mg/mL 7-aminocephalosporanic acid (7-ACA ...
-
bioRxiv - Neuroscience 2021Quote: ... mechanically dissociated cortices from P1-3 Wistar rats were cultured in poly-D-lysine (PDL)-coated (10 μg/mL; Sigma P7886) tissue culture plates (diameter 10 cm ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were plated onto collagen-coated plates in Opti-MEM for 3 hours and subjected to respective treatment conditions of either glucose (D-(+)-Glucose (Sigma Aldrich) or erythropoietin (Roche) ...
-
bioRxiv - Cell Biology 2021Quote: ... Dissociated testicular cells in PBS were fixed with PFA in 4% concentration for 5 minutes followed by centrifugation at 250 x g for 3 minutes to attach to coverslips coated with poly-D-lysine (Sigma Aldrich). Testicular cells were air-dried shortly ...
-
bioRxiv - Molecular Biology 2019Quote: ... HeLa cells were treated with 60 μM of the adenosine analogue 5,6-dichloro-1-3-D-ribofuranosylbenzimidazole (DRB; Sigma-Aldrich®) to inhibit transcription and RNA was extracted at different time points for further RT-qPCR analysis.
-
bioRxiv - Cell Biology 2022Quote: ... The release of the RUSH cargos from the ER-hook was induced by removing the streptavidin supplemented media and addition of biotin supplemented media (3 mM of D-biotin, B4501 Sigma-Aldrich) for the indicated times.
-
bioRxiv - Bioengineering 2023Quote: ... 100 mM NaCl with 0.1% n-Dodecyl-B-D-Maltoside to remove excess SDS by using an 30 kDa amicon centrifugal filter (1/10 dilution, 3 times; EMD Millipore) before a final overnight dialysis (1/500 dilution ...
-
bioRxiv - Microbiology 2022Quote: The AHL signaling molecules used in this study are N-(3-oxododecanoyl)-L-homoserine lactone (3-oxo-C12-HSL, Sigma-Aldrich CAS# 168982-69-2), N-butyryl-homoserine lactone (C4-HSL ...
-
bioRxiv - Neuroscience 2023Quote: ... The sections were then dehydrated in ascending concentrations of ethanol for 5 min each (2[×[35%, 50%, 70%, 80%, 90%, 3[×[100%) and washed 3 times for 5 min with propylene oxide (Sigma-Aldrich, #cat 110205-18L-C). Next ...
-
bioRxiv - Cell Biology 2019Quote: ... The reaction started with 700 µl of 2 mg/ml of o-nitrophenyl-β-D-galactoside (ONPG, Sigma) in Z buffer ...
-
bioRxiv - Biophysics 2021Quote: ... 2 x 105 cells per 60 mm culture dish were seeded on poly-D-ornithine (Sigma Aldrich, P8638) coated #1.5 18 mm glass coverslips (Marienfeld ...
-
Nanoparticle-delivered TLR4 and RIG-I agonists enhance immune response to SARS-CoV-2 subunit vaccinebioRxiv - Immunology 2022Quote: ... spleens from female Balb/cJ mice were dissociated in 2 mg/mL Collagenase D (Sigma-Aldrich, Cat# 11088882001) in Opti-MEM media (Gibco ...
-
bioRxiv - Genetics 2022Quote: ... Yeast cells were cultured in synthetic complete (SC) medium (2% D-galactose, 0.67% yeast nitrogen base without amino acids, 0.2% drop out (Sigma), (0.0076% uracil ...
-
bioRxiv - Plant Biology 2020Quote: ... Pip and NHP were quantified against external standard curves of (D,L-piperidine-2-carboxylic acid, Sigma-Aldrich) and NHP with six calibration points ...
-
bioRxiv - Molecular Biology 2021Quote: ... Single cycle infected cells were treated at 2 days post infection with 5µg/ml Actinomycin D (Sigma A9415), and harvested 0 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The nuclear protein lysate then was pre-cleared by adding 2 μL of poly D[IC] (Sigma-Aldrich) 25 µg/µL and 20 μL of High Capacity Strepavidin agarose beads (Thermofisher #20357) ...
-
bioRxiv - Cell Biology 2024Quote: ... 2% homemade NS-21 (Chen et al., 2008) and 4 µM cytosine β-D-arabinofuranoside (Millipore Sigma C6645). Neurons were incubated at 37 °C in a 95% air/5% CO2 incubator until imaging.
-
bioRxiv - Developmental Biology 2019Quote: ... pH 6 (Sigma) at 95 °C for 20 minutes then room temperature for 20 minutes prior to staining ...
-
bioRxiv - Biochemistry 2020Quote: ... were pooled together (6 mL) and concentrated/buffer exchanged using an Amicon® Ultra-4 Centrifugal Filter Units (3 kDa, Millipore, Ireland). The final volume of the purified bacteriocin protein fraction was reduced to 200 μL ...
-
bioRxiv - Biochemistry 2022Quote: ... using the absorbance measurement of 2,2′-Azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS) substrate at 405 nm (Sigma Aldrich Catalog # 11468120910).
-
bioRxiv - Immunology 2024Quote: ... The minced tumor tissue was transferred to a 6-well plate containing 3 mL/well of tumor digestion media (NK cell media + 1 mg/mL collagenase IV (Sigma, cat. C5138) + 0.2 mg/mL DNAse I (Roche ...
-
bioRxiv - Cancer Biology 2024Quote: ... BxPC-3 cells were transduced with retroviral particles in a 6-well plate using polybrene transfection reagent (EMD MIllipore, TR-1003-G) and incubated for 48 h at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) was used for cell viability (Sigma, Israel).
-
bioRxiv - Biophysics 2021Quote: ... The bottom coverslip was functionalized with an amino-group in the 2% 3-aminopropyltheithoxysilane (440140, Sigma) in acetone for 10 min ...
-
bioRxiv - Biochemistry 2020Quote: ... The sequence of the biotinylated 2’-deoxyoligonucleotide is 5’ – (Biotin) AAATGGTGCCGAAACCCGGGATCGAACCAGGGT – 3’ (Sigma Aldrich, Munich, Germany)
-
bioRxiv - Neuroscience 2021Quote: ... Amigo2-icreER;ROSA-TdTomato mice were given 2 or 3 daily intraperitoneal injections of tamoxifen (Sigma T5648 ...
-
bioRxiv - Neuroscience 2019Quote: ... embedded with sucrose 30% for 3 days and finally frozen in 2-methylbutane (Sigma-Aldrich, France) at −80°C ...
-
bioRxiv - Cell Biology 2021Quote: ... and washed 3 times in 1x PBS and 2 times in 2x SSC buffer (Sigma-Aldrich) for five min each ...
-
bioRxiv - Neuroscience 2021Quote: ... frozen VMH (from 2 – 3 mice) was homogenized in Lysis Buffer (EZ Prep Nuclei Kit, Sigma) with Protector RNAase Inhibitor (Sigma ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cell viability was evaluated by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Sigma) assay as described previously(Lv et al ...