Labshake search
Citations for Millipore Sigma :
1651 - 1700 of 10000+ citations for 6 Chloro 7H pyrrolo 2 3 d pyrimidine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... followed by measuring β-galactosidase activity measurement using 2-Nitrophenyl β-D-galactopyranoside (Sigma, St. Louis, MO, cat #N1127) as substrate.
-
bioRxiv - Immunology 2021Quote: ... HCMV titers were determined by counting GFP+ foci on HFF 2 d post infection using a 1.2% methylcellulose (Sigma) overlay ...
-
bioRxiv - Neuroscience 2022Quote: ... and NMDA receptor mediated PSCs were blocked with DL-2-amino-5-phosphonopentanoic acid (D-AP5; 50 μM; Sigma). The AMPA-R PSC frequency and amplitude was determined from a 1 min interval after the recording had stabilized (~10 min after wash-in of picrotoxin/D-AP5) ...
-
bioRxiv - Cell Biology 2020Quote: Fully differentiated C2C12 MS2-CAS myotubes were starved in serum-and glucose-free DMEM supplemented with BSA 0.1% for 2.5 hrs before a 10-min incubation in Krebs-Ringer Phosphate HEPES (KRPH) buffer [pH 7.4]/BSA 0.1% supplemented with a mixture of cold deoxyglucose (2-Deoxy-D-glucose; Sigma-Aldrich) and radiolabeled deoxyglucose (Deoxy-D-glucose ...
-
bioRxiv - Immunology 2022Quote: Decreasing concentrations of recombinant DC-SIGN or rfhSP-D (2, 1, 0.5 or 0 µg 100µl/well) were coated on polystyrene microtiter plates (Sigma-Aldrich) at 4°C overnight using carbonate/bicarbonate (CBC ...
-
bioRxiv - Cell Biology 2022Quote: ... Tubes were kept at 37°C in a heating block (DB200/2; Techne) and D-biotin (B4501; Sigma-Aldrich) at a final concentration of 500 μm was added at each time point (for the majority of experiments 35 min) ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were differentiated in osteogenic media for 14 or 21 days then treated with 10−8M 1,25(OH)2 vitamin D (Sigma) or vehicle (DMSO ...
-
bioRxiv - Cell Biology 2020Quote: ... corneal tissues were extracted from mice and incubated in 50 μL of 2 mg/mL collagenase D (Sigma C0130) in PBS for 1 h at 37°C ...
-
bioRxiv - Immunology 2021Quote: ... the γ-secretase inhibitor (2S)-N-[(3,5-Difluorophenyl)acetyl]-L-alanyl-2-phenyl]glycine 1,1-dimethylethyl ester (DAPT; R&D) or dimethyl sulfoxide (DMSO; Sigma) was added to media at the concentrations indicated.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and 100 mM 2-deoxy-D-glucose were sequentially injected in 25 µL volume (all reagents from Sigma-Aldrich). All XF96 protocols consisted of 4 times mix (2 min ...
-
bioRxiv - Neuroscience 2023Quote: ... They were then added to 2 mL of digestion buffer (RPMI containing Collagenase D (2mg/mL; Sigma-Aldrich; 11088882001), Collagenase 11 (2mg/mL ...
-
bioRxiv - Immunology 2023Quote: ... disrupted (between 2 frosted glass slides) and digested with 1mg/ml of collagenase D (Sigma Life Science; ref # 11088882001) and 100µg/ml of DNAse I (Sigma Life Science ...
-
bioRxiv - Microbiology 2023Quote: ... D-alginate was produced by enzymatically degrading 2% alginate with 1 unit ml-1 of alginate lyase (Sigma Aldrich) at 37 °C for 24 hours ...
-
bioRxiv - Molecular Biology 2020Quote: ... Up to 180mL of blood was collected into 3 60 mL syringes pre-loaded with 6 mL of anticoagulant acid citrate dextrose (ACD) (Sigma C3821 Lot#SLBW6172). Within 15 min of collection ...
-
bioRxiv - Neuroscience 2020Quote: Male CD-1 mice aged 6-10 weeks were given an ip injection of 3 mg/kg LPS from Salmonella typhimurium (Sigma, St. Louis, MO) dissolved in sterile normal saline at 0 ...
-
bioRxiv - Plant Biology 2021Quote: ... medium, containing 3% sucrose, 10−6 M potassium indole acetate (Nacalai Tesque, Kyoto, Japan) and 10−5 M kinetin (Sigma, St. Louis, MO) at 25 °C ...
-
bioRxiv - Cell Biology 2022Quote: 12- week-old C57BL/6 male mice were injected intraperitoneally with CCl4 (HPLC grade, Cat#270652, Sigma, diluted 1:3 in mineral oil) or mineral oil (control ...
-
bioRxiv - Cell Biology 2022Quote: ... 3 μM-sections were deparaffinized and antigen retrieval was performed in 10 mM citrate buffer (pH = 6; Sigma-Aldrich, St Louis, MO, USA) for 10 min ...
-
bioRxiv - Immunology 2022Quote: ... a known volume of trolox standard concentration would result in a similar reduction of the radical 2,2’-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid (Sigma-Aldrich, St. Louis, MO). Samples were analyzed in triplicate ...
-
bioRxiv - Zoology 2022Quote: The frogs underwent double euthanasia according to institutional ethics guidelines under ethics approval number NWU-00380-16-A5-01: first anaesthesia in 6% ethyl-3-aminobenzoate methansulfonate (MS222) (Sigma-Aldrich Co., USA) and then euthanasia through pithing.
-
bioRxiv - Developmental Biology 2023Quote: Zebrafish larvae were anesthetized with 1 mg/ml Tricaine and transferred to a 6-well glass-bottom plate containing 3% methylcellulose (Sigma-Aldrich, MO, USA) in E3 medium ...
-
bioRxiv - Cancer Biology 2023Quote: ... were deparaffinized and then subjected to antigen retrieval for 10 minutes at 121 uC at 15 PSI in 2.94 g/L sodium citrate (pH 6; Sigma Aldrich, 61332-04-3). Sections were permeabilized in PBS with 0.4% Triton X-100 (PBT ...
-
bioRxiv - Plant Biology 2023Quote: ... 1.5-ml glass vials (Ø×H 11.6 × 32 mm) containing ∼ 100 mg glass wool were filled with 200 µl (Z)-3-hexenyl acetate (HAC, >98%, Sigma-Aldrich, Buchs, Switzerland) and sealed with screw caps containing a rubber septum ...
-
bioRxiv - Pathology 2020Quote: Ela-Cre AT-1fl/+ and Ela-Cre AT-1fl/fl mice at 2-3 months of age were treated with tamoxifen (MP Biomedicals, 3mg/40g BW dissolved in 98% corn oil [Sigma] and 2% ethanol [Sigma]) by oral gavage once daily for three days to induce Cre recombinase activity ...
-
bioRxiv - Microbiology 2019Quote: ... A 200 μL aliquot of a solution containing 100 μg/μL of XTT (2, 3-(2-methoxy-4-nitro-5-sulfophenyl)-5-[(phenylamino) carbonyl]-2H-tetrazolium hydroxide) (Sigma-Aldrich, St Louis, MO, USA) and 10 μg/μL of PMS (phenazine methosulfate ...
-
bioRxiv - Biophysics 2021Quote: ... The cantilevers were functionalized with amine groups by immersing in 2% (vol/vol) 3-aminopropyltriethoxysilane (Millipore Sigma) solution dissolved in acetone ...
-
bioRxiv - Microbiology 2019Quote: Primers used in this study (Table 2) were designed with Primer 3 (http://bioinfo.ut.ee/primer3-0.4.0/) and synthesized by Sigma-Aldrich.
-
bioRxiv - Cell Biology 2019Quote: Cell viability was assessed with 3-[4,5-Dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT, #M5655, Sigma Aldrich) after treatment with MMC and the PARP inhibitor Olaparib (AZD2281 ...
-
bioRxiv - Bioengineering 2021Quote: ... was added to the PEG solution followed by the addition of 1-[bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate] (HATU; 2.43 g, 6.4 mmol, 2 eq.; Sigma-Aldrich). Next ...
-
bioRxiv - Immunology 2022Quote: ... 2- or 3-days post fertilisation (dpf) zebrafish were anaesthetised in 0.168 mg/ml Tricaine (Sigma-Aldrich) in E3 media and visualised under a dissecting microscope ...
-
bioRxiv - Biochemistry 2021Quote: ... cell viability was determined using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich, MO) as described previously.52 Equivalent MTT assays were performed on cells cultured in the same ratios of PBS to media ...
-
bioRxiv - Microbiology 2021Quote: ... sporozoites were added to 1 ml molten 3% agarose (2-Hydroxyethyl agarose – Sigma-Aldrich, dissolved in ddH2O), centrifuged and incubated at 4°C for 5 min ...
-
bioRxiv - Immunology 2021Quote: ... or 25 µM (L-3-trans-(Propylcarbamyl) oxirane-2-carbonyl)-L-isoleucyl-L-proline (CA-074me) (Sigma) to inhibit cathepsin B ...
-
bioRxiv - Molecular Biology 2020Quote: ... For cell treatments the following compounds were used: 2′,3′-Dideoxycytidine (1-10 μM, Sigma-Aldrich®), Ethidium bromide (50 ng/mL ...
-
bioRxiv - Biochemistry 2022Quote: ... and trans-4-Phenyl-3-buten-2-one (20a) were purchased from Sigma-Aldrich (St. Louis, MO). Ketoisophorone (2a ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and thus 3-[2-(diethylamino)ethyl]-7-hydroxy-4-methylcoumarin (AHMC; Cat. No. 188611, Sigma-Aldrich Corp.) was used instead as previously described for the fluorescence quantification (Donato et al ...
-
bioRxiv - Pathology 2019Quote: ... a cell-permeant NO scavenger 2-(4-car-boxyphenyl)-4,4,5,5-tetramethylimidazoline-1-oxyl-3-oxide (cPTIO) (Sigma) at a high concentration of 500 μM was included ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 mg total protein were mixed with 2 mL Urea Buffer (UB) (8 M urea (Sigma, U5128) in 0.1 M Tris/HCl pH 8.0 and 50mM ammonium bicarbonate) ...
-
bioRxiv - Cancer Biology 2020Quote: ... collected and lysed with NP-40 lysis buffer supplemented with phosphatase inhibitor cocktails 2 and 3 (Sigma) and protease inhibitor mix (Sigma) ...
-
bioRxiv - Microbiology 2019Quote: ... 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide was dissolved in Dulbecco’s PBS (-) (Sigma-Aldrich, India) (pH 7.4 ...
-
bioRxiv - Microbiology 2021Quote: ... Plates were incubated for 3 hours before addition of 30 μL of the bacterial growth reporter MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] (2.5 mg/mL) (Sigma) and Tween 80 (10% ...
-
bioRxiv - Biochemistry 2020Quote: ... phosphatidyl-choline (2-oleoyl-1-palmityl-sn-glycero-3-phosphocholine) were from Sigma-Aldrich (St. Louis, MO); Ezetimibe and lysophosphatidylcholine (1-palmitoyl-sn-glycero-3-phosphocholine ...
-
bioRxiv - Developmental Biology 2020Quote: ... Phosphopeptide standards (0.1 pmol of MS PhosphoMix 1, 2, 3 Light; Sigma-Aldrich, St. Louis, Missouri, USA) was added to suspended sample in binding/equilibration buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... coli polar lipids (Avanti, US) and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) (Sigma Aldrich) in a 3:1 molar ratio ...
-
bioRxiv - Biochemistry 2021Quote: ... phosphatase inhibitor cocktail 2 and phosphatase inhibitor cocktail 3 were purchased from Sigma-Aldrich (St. Louis, MO). All other chemicals including V8 protease were purchased from FUJIFILM Wako ...
-
bioRxiv - Neuroscience 2021Quote: ... A CRISPR-Cas9 crRNA (5’- GAGGCCAAGATGAGTACTGAGG-3’) targeting exon 2 of Blvra was synthesized by Sigma Aldrich. A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: Polyacrylamide (PA) gels of varying stiffness (0.5, 2, and 5 kPa) were fabricated on 3-APTMS (Sigma) functionalized glass coverslips by combining 40% acrylamide and 2% bis-acrylamide in specific ratios as described previously [81] ...
-
bioRxiv - Cancer Biology 2021Quote: Cell proliferation was assessed by 3-(4,5-1,2methylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Merck Millipore). K562 cells (5,000/well ...
-
bioRxiv - Microbiology 2020Quote: ... and 0.1 mM IBMX (3,7-dihydro-1-methyl-3-(2-methylpropyl)-1H-purine-2,6-dione) (Sigma Aldrich)) ...
-
bioRxiv - Neuroscience 2022Quote: ... The 2 odors used were 3-Oct (Sigma-Aldrich Cat# 218405-250G; CAS Number: 589-98-0) and MCH (Sigma-Aldrich Cat# 66360-250G ...