Labshake search
Citations for Millipore Sigma :
1451 - 1500 of 4429 citations for PCR Plates since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Vectors were generated by inverse PCR using KOD Hot-start polymerase (Novagen) or by Gibson assembly in a homemade reaction master mix (100 mM Tris-Cl pH 7.5 ...
-
bioRxiv - Molecular Biology 2020Quote: ... A PCR with REDTaq® DNA polymerase (Sigma-Aldrich, Saint Louis, Missouri) was performed and the length of the amplified products was checked by 1% agarose gel electrophoresis ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was diluted 1:10 mixed with 1x PCR buffer (Sigma Aldrich), 1.5 mM MgCl2 ...
-
bioRxiv - Biochemistry 2021Quote: ... The digested PCR product was cloned into a pET-52b(+) plasmid (Novagen) in frame with an N-terminal Strep-tag II obtaining the B35SSB expression vector pET52b::B35SSB ...
-
bioRxiv - Genomics 2019Quote: ... with the SYBR Green JumpStart Taq ReadyMix for Quantitative PCR (Sigma Aldrich). Using the Primer3 software70 ...
-
ACE2-lentiviral transduction enables mouse SARS-CoV-2 infection and mapping of receptor interactionsbioRxiv - Microbiology 2021Quote: ... Mice were genotyped using Extract-N-Amp Tissue PCR Kit (Sigma Aldrich) according to manufacturer instructions with the following primers ...
-
bioRxiv - Cancer Biology 2021Quote: ... along with mycoplasma testing using the LookOut Mycoplasma PCR Detection Kit (Sigma).
-
bioRxiv - Immunology 2021Quote: ... and fluorescence imaging and LookOut® Mycoplasma PCR detection kit (Sigma-Aldrich). Primary antibodies used for immunohistochemistry included ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR amplification using KOD Xtreme™ Hot Start DNA Polymerase (Millipore, 71975) and the primers TCGATGCTCTGTTTCGAATG and CTTCTTCCCCCTTGCCTTAC flanking the targeted deletion site ...
-
bioRxiv - Genetics 2021Quote: ... The PCR master-mix used was: Taq polymerase (Novagen NovaTaq 0.04U/μL), primers (0.5 μM each) ...
-
bioRxiv - Immunology 2020Quote: ... Amplified S-gene and polymerase chain reaction (PCR) engineered pET31b(+) (Novagen, Germany) bacterial expression vector were amplified using 0570F and 0571R primers ...
-
bioRxiv - Biochemistry 2022Quote: ... brucei genomic DNA using PCR and ligated into the pET15b vector (Novagen), which provides an N-terminal His6 tag followed by a thrombin cleavage site prior to the target protein ...
-
bioRxiv - Molecular Biology 2022Quote: ... The PCR was performed using KOD Hot start DNA polymerase (Millipore Sigma) since it has a low error rate unlike Taq polymerase (Engler and Marillonnet 2013) ...
-
bioRxiv - Physiology 2022Quote: ... and purified with the GenElute™ PCR Clean-Up Kit (SIGMA NA1020). 300 ng of the eluted DNA was digested overnight at 37°C with the restriction enzymes including USP8 – BstBI and USP48 – SpeI ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR was performed using JumpStart REDTaq Ready Mix (Sigma, Cat#P0982-800RXN) and the primers listed below ...
-
bioRxiv - Molecular Biology 2022Quote: ... and splice isoform specific PCRs were performed (Sigma Aldrich High fidelity Taq) using appropriate primers (Supplemental table 8 ...
-
bioRxiv - Systems Biology 2022Quote: ... PCR was performed with a proof-reading KOD polymerase (Sigma-Aldrich, 71086) using vector-specific primers.
-
bioRxiv - Neuroscience 2023Quote: ... and PCR amplification was performed using KAPA2G ReadyMix Kit (Sigma Aldrich, KK5103) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... All PCRs were performed using KOD Hot Start DNA polymerase (EMD Millipore) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: PCRs were performed with the KAPA3G Plant kit (Sigma Aldrich, MO, USA) using the following conditions ...
-
bioRxiv - Developmental Biology 2023Quote: ... PCR amplification was performed using KOD Hot Start Master Mix (Millipore Sigma) with primers listed in Supplementary Table 6 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... PCR reactions were performed using the KOD Hotstart DNA polymerase (Merck Millipore). Plasmid isolation ...
-
bioRxiv - Neuroscience 2023Quote: ... Following the RED Extract-N-Amp Tissue PCR XNAT manufacturer’s protocol (Sigma), 2-3mm of each mouse’s tail was removed and DNA was extracted ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR mixture consisted of MTP Taq DNA Polymerase (Sigma-Aldrich, Germany) (0.05 u/μL ...
-
bioRxiv - Plant Biology 2023Quote: ... All PCRs were performed using KOD Hot Start DNA Polymerase (EMD Millipore). In the via-1 strain ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR reaction contained 1.25 U JumpStartTM Taq DNA Polymerase (Sigma-Aldrich), 1× PCR Buffer (Sigma-Aldrich) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Sanger sequencing of the PCR products was performed using commercial service (Sigma). The sequencing traces were examined and the fish carrying A to G mutation were selected ...
-
bioRxiv - Cell Biology 2020Quote: ... Isolated lipids were spotted onto heated glass-backed silica gel 60 plates (Millipore Sigma 1057210001), and neutral lipids were separated in a mobile phase of 80:20:1 hexane:diethyl ether:glacial acetic acid ...
-
MANF regulates unfolded protein response and neuronal survival through its ER-located receptor IRE1αbioRxiv - Cell Biology 2020Quote: ... Cells were plated onto the 96-well plates coated with poly-L-ornithine (Sigma-Aldrich). Equal volumes of cell suspension were plated onto the center of the dish ...
-
bioRxiv - Immunology 2021Quote: ... Plates were washed (5 times with PBS-T) and developed with either AP substrate (Sigma) and read at 405 nm (AP ...
-
bioRxiv - Immunology 2021Quote: ... An additional plate was coated with goat anti-human IgG (Sigma, cat. no. I2136-1ML) at 4 μg/ml and IgM (Sigma ...
-
bioRxiv - Molecular Biology 2021Quote: ... Prior to cell seeding the plates were treated with 0.01% Poly-L-Ornithine (Millipore, A004C) for at least 20 min ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were further cultured on plates coated with 7.5 μg/ml Fibronectin (Sigma, cat. F1141) in EpiSCs medium ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were further cultured on plates coated with 7.5 μg/ml Fibronectin (Sigma, cat. F1141) in the same medium ...
-
bioRxiv - Developmental Biology 2020Quote: ... 20 day-one adult animals were transferred onto NGM plates containing 1 mM aldicarb (Sigma) without food ...
-
bioRxiv - Developmental Biology 2020Quote: ... 100µL transformation mix was spread on an Agar plate containing 100µg/mL Ampicillin (A5354, Sigma) and incubated over night at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... Immediately prior to plating on agar plates containing 20 mM 4-chloro-phenylalanine (Sigma-Aldrich), the cells were washed twice with phosphate-buffered saline (PBS ...
-
bioRxiv - Neuroscience 2021Quote: ... plates or dishes were coated with 10 µg/ml Poly-L-Ornithine (PLO, Sigma, P4957) in PBS for at least 2 h ...
-
bioRxiv - Neuroscience 2021Quote: ... We used plates containing either 0.5 mM or 1 mM final aldicarb (33386 Sigma-Aldrich) concentration in the NGM ...
-
bioRxiv - Immunology 2021Quote: ... plates were washed and incubated for 30 minutes with 1μg/ml Streptavidin-Alkaline Phosphatase (Sigma). Finally plates were washed and developed with BCIP®/NBT (Sigma).
-
bioRxiv - Immunology 2021Quote: ... The plates were then washed 3 times with PBS containing 0.05% Tween-20 (Sigma-Aldrich), blocked with 150 mL ELISA/ELISPOT Diluent (Life Technologies Corporation ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 × 103 cells were seeded into 96-well plates and stained with MTT (Sigma-Aldrich) dye ...
-
bioRxiv - Physiology 2019Quote: ... on LB Agar Bacterial resistant plates (50 μg/ml Spectinomycin Sigma Aldrich cat no. S4014) in SOC medium (Invitrogen cat no ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Spores were harvested from plates in 1 mL of 0.1% Tween 80 (Sigma, MO, USA) and after counting under Neubauer chamber ...
-
bioRxiv - Developmental Biology 2019Quote: ... Injected animals were grown on NGM plates supplemented with 1 mM auxin (Sigma-Aldrich, I2886). Injection mixes contained pCFJ601 (Peft-3∷transposase ...
-
bioRxiv - Cell Biology 2020Quote: ... 7 μL sample was spotted on a polyethylenimine (PEI) cellulose TLC plate (Sigma-Aldrich, Z122882), and resolved using 0.75 M LiCl ...
-
bioRxiv - Microbiology 2019Quote: ... The transformed cells were selected on plates containing 300 mg/L Hygromycin B (Sigma-Aldrich). Colony PCR using primer pairs 1055F/2951R and STA1_UAS_Fw/STA1_UAS_Rv ...
-
bioRxiv - Cancer Biology 2019Quote: ... Each plate was transfected with 20 μg of overexpression plasmid with 100 μg PEI (Sigma). After 48 h cells were collected in TBS ...
-
A tyrosine kinase protein interaction map reveals targetable EGFR network oncogenesis in lung cancerbioRxiv - Cancer Biology 2020Quote: ... Cells were reverse transfected in quadruplicate in 384-well plates with 20nM of siRNA (Sigma) using RNAiMax as transfection reagent ...
-
bioRxiv - Microbiology 2021Quote: ... Environmental water aliquots were also plated on LB agar plates (Sigma-Aldrich, St. Louis, MO) to estimate live bacteria quantities prior to freezing at −80°C.