Labshake search
Citations for Millipore Sigma :
1351 - 1400 of 10000+ citations for 5 Chloro 1 vinyl 2 pyridone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... PBS 1× supplemented with 2 mM EDTA (Sigma-Aldrich) and 2% FCS for 30 min at 4 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... 1% 2-mercaptoethanol 100X (Sigma-Aldrich, ES-007-E), 1% non-essential amino acids 100X (Thermo Fisher ...
-
bioRxiv - Zoology 2024Quote: ... 2-Methyl-1-propanol (Sigma-Aldrich, 99.5%, for GC), chloroform (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... 1% 2-mercaptoethanol 100X (Sigma-Aldrich, ES-007-E), 1% non-essential amino acids 100X (Thermo Fisher ...
-
bioRxiv - Cell Biology 2024Quote: ... 1% 2- mercaptoethanol 100X (Sigma-Aldrich, ES-007-E), 1% non-essential amino acids 100X (Thermo Fisher ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 µg ml-1 (w/v) pepstatin-A (Sigma) and 0.334 mM PMSF (Sigma) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and dispase II (2 U ⋅ mL−1; Sigma-Aldrich), filtered through a 100 µm cell strainer ...
-
bioRxiv - Developmental Biology 2024Quote: ... and rat anti-Laminin-2 (1:500; Sigma; L0663) at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... or anti-AGO1-N-coil (1:1000 in 5% milk in PBS-T) followed by anti-Rabbit antibody (1:10,000 [Sigma] in 5% milk in PBS-T). The anti-AGO1-N-coil antibody was detected with anti-Rabbit antibody conjugated to HRP (1:2,000 [Sigma] in 5% milk in PBS-T) ...
-
bioRxiv - Cell Biology 2022Quote: ... Corresponding secondary HRP-conjugated anti-rabbit (1:3000 or 1:2000 in 5% non-fat milk or 5% BSA/TBS-T; Sigma-Aldrich, St. Louis, MO, USA) was used for a 1-hour incubation at room temperature ...
-
bioRxiv - Developmental Biology 2020Quote: ... nuclei were stained with DAPI (2 μg/ml, room temperature, 5 min, Sigma, St. Louis, Missouri, USA).
-
bioRxiv - Plant Biology 2022Quote: ... DSF supplementation was performed by adding with 5 μM of cis-11-methyl-2-dodecenoic acid (Sigma) to the media.
-
bioRxiv - Molecular Biology 2020Quote: ... 10% FCS and human fibroblast growth factor-2 (5 ng/mL, Sigma-Aldrich, St Louis, MO, USA) at 37 °C ...
-
bioRxiv - Neuroscience 2020Quote: ... the sections were counterstained with DAPI (4′,6-diamidino-2-phenylindole dihydrochloride; 5 µg/ml, Sigma-Aldrich) at room temperature for 20 minutes.
-
bioRxiv - Microbiology 2021Quote: ... The minimal medium was supplemented with 5 mM 2-(N-morpholino) ethanesulfonic acid (Mes: Sigma Chemical Co.) adjusted to pH 6.4 with NaOH as buffer and 0.5% (w/v ...
-
bioRxiv - Microbiology 2021Quote: 20 μg of fraction 19 were reduced with 5 mM Tris(2-carboxyethyl)phosphine (646547, Sigma Aldrich) for 60 min at 65 °C ...
-
Observation of an α-synuclein liquid droplet state and its maturation into Lewy body-like assembliesbioRxiv - Molecular Biology 2020Quote: ... larvae were placed on nematode growth medium (NGM) plates containing 5-fluoro-2’deoxy-uridine (FUDR, Sigma) (75 μM ...
-
bioRxiv - Microbiology 2020Quote: ... Continuous culture was typically carried at 2-5%-hematocrit in RPMI-1640 (Sigma Aldrich, Cat. No. R6504) supplemented with HEPES ...
-
bioRxiv - Immunology 2022Quote: Total RNA was collected from cultured cells treated with 100 nM 5-aza-2⍰-deoxycytidine (decitabine; Sigma) or splenocytes from a naïve C57BL/6 mouse using NucleoSpin RNA Plus (Takara) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Samples were combined with NuPage LDS sample buffer 4x (#2083421) and 5% 2-Mercaptoethanol (Sigma Aldrich #M6250) and heated for 10 minutes at 70°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... and (+−)-6-hydroxy-2,5,7,8- tetra- methylchromane-2-carboxylic acid (Trolox) (cat: 238813-5 G) were ordered from Sigma. Potassium chloride (cat ...
-
bioRxiv - Neuroscience 2021Quote: ... A CRISPR-Cas9 crRNA (5’- GAGGCCAAGATGAGTACTGAGG-3’) targeting exon 2 of Blvra was synthesized by Sigma Aldrich. A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... before fixation for 5 hrs in humid conditions at 37 °C in 1.4% / 2% formaldehyde (F8775 Sigma) / acrylamide (A4058 Sigma) ...
-
bioRxiv - Cancer Biology 2021Quote: Polyacrylamide (PA) gels of varying stiffness (0.5, 2, and 5 kPa) were fabricated on 3-APTMS (Sigma) functionalized glass coverslips by combining 40% acrylamide and 2% bis-acrylamide in specific ratios as described previously [81] ...
-
bioRxiv - Neuroscience 2020Quote: All birds received intramuscular injections of 5-Bromo-2’-deoxyuridine (BrdU; 74 μg/g, pH 7.4, Sigma) 3x/day for three days to label mitotically active cells ...
-
bioRxiv - Immunology 2021Quote: ... in the presence of 4-amino-5 methylamino-2’ s,7’-difluorofluorescein (DAF-FM) diacetate (Sigma, D1946). DAF fluorescence intensities were measured every 5 minutes for a total of 60 minutes using a SpectraMax iD3 (Molecular Devices) ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were then blocked for 2☐h in 5% bovine serum albumin (BSA, Sigma-Aldrich, A7906) in 0.01☐M PBS and 0.3% Triton X-100 (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... The parasites (ring stage; 2-4 hpi) were tightly synchronized with 5% (v/v) D-sorbitol (Sigma) and then monitored by Giemsa staining of methanol-fixed blood smears ...
-
bioRxiv - Genomics 2020Quote: ... the cells were spun down and moved to “Phase 2” IMDM media containing 5% human serum (Sigma), 330µg/mL transferrin ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.5 μl of 30 mM D-(-)-2-Amino-5-Phosphonopentanoic acid (D-APV, Sigma Aldrich, Cat #: A8054) dissolved in ACSF (Wang ...
-
bioRxiv - Neuroscience 2023Quote: ... short term neighbor rescue experiment NSCs were incubated with 20 µM 5-bromo-2’-deoxyuridine (BrdU) (Sigma) for 2 hours then fixed with 4% paraformaldehyde prior to immunohistochemical processing ...
-
bioRxiv - Physiology 2022Quote: ... they were picked onto NGM treatment plates containing 49.5 μM 5-fluoro-2’-deoxyuridine (FUDR, Sigma F0503) to prevent progeny production and either α-KB or vehicle (water ...
-
bioRxiv - Physiology 2023Quote: ... The NC membrane was initially blocked with 5% nonfat milk and 2% BSA (A4503, Sigma (v/v)) in tris buffered saline with 0.1% Tween 20 (93773 ...
-
bioRxiv - Physiology 2023Quote: ... The NC membrane was initially blocked with 5% nonfat milk and 2% BSA (A4503, Sigma (v/v)) in Tris buffered saline with 0.1% Tween 20 (93773 ...
-
bioRxiv - Microbiology 2024Quote: ... and Tuba (5’-CAGAATCATGATGAGGCCAtt-3’. These siRNAs were obtained from Sigma-Aldrich (Dyn2-2 and Dyn2-3) or Qiagen (Tuba ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were incubated for 24 h in medium containing 2 mM thymidine (Sigma-Aldrich, 50-89-5), followed by release in fresh medium ...
-
bioRxiv - Genetics 2023Quote: ... Cells are then blocked with 2 mL blocking solution made of 5% BSA (cat#A3059-10G Sigma) and 0.05% Triton X-100 in PBS for 2 hours at RT or 4°C on a shaker.
-
bioRxiv - Neuroscience 2023Quote: ... 3-dione (CNQX) and 50 mM D,L-2-amino-5-phosphonovaleric acid (APV) acquired from Sigma to suppress post-synaptic responses ...
-
bioRxiv - Biochemistry 2023Quote: ... then 250 µL of neurobasal supplemented with 40 µM of 5-fluoro-2’-deoxyuridine (FUDR, Sigma F0503) and NGF was carefully added to the well ...
-
VPS13B is localized at the cis-trans Golgi complex interface and is a functional partner of FAM177A1bioRxiv - Cell Biology 2023Quote: ... and (+−)-6-hydroxy-2,5,7,8-tetra-methylchromane-2-carboxylic acid (Trolox) (cat: 238813-5 G) were ordered from Sigma. 1× Phosphate Buffered Saline (PBS ...
-
Activation of glucocorticoid receptor signaling inhibits KSHV-induced inflammation and tumorigenesisbioRxiv - Cancer Biology 2023Quote: ... Cell cycle was examined by flow cytometry following 5′-bromo-2′-deoxyuridine (BrdU) labeling (BrdU: Sigma-Aldrich, MB5002 ...
-
bioRxiv - Cancer Biology 2022Quote: ... S-phase populations were identified by incorporation of 10 μM 5-ethynyl-2’-deoxyuridine (EdU; Sigma-Aldrich) 45 min before fixation ...
-
bioRxiv - Cell Biology 2022Quote: ... A small piece of frozen BAT (2 – 5 mg) was transferred into a BeadBug tube (Sigma Aldrich) containing 1.0 mm zirconium beads (Merck ...
-
bioRxiv - Developmental Biology 2022Quote: Time-pregnant mice were injected with 5-bromo-2’deoxyuridine (BrdU) (50 mg/kg body weight, Sigma) 1 h before the harvest of embryos ...
-
bioRxiv - Neuroscience 2023Quote: Mice were injected intraperitoneally (i.p.) once with 150 mg/kg of 5-bromo-2′-deoxyuridine (BrdU; Sigma) 24 hours before sacrifice for cell proliferation assessment ...
-
bioRxiv - Neuroscience 2022Quote: ... and ≥99% 4-methyl-3-heptanol and 99% 6-methyl-5-hepten-2-one from Sigma-Aldrich (Item numbers M48309 and M48805-100ML ...
-
bioRxiv - Cell Biology 2023Quote: ... The dermis was injected with approximately 2-5 μl TAT-Cre recombinase (200 U/ml; Sigma-Aldrich) using a glass microcapillary pipette ...
-
bioRxiv - Genomics 2023Quote: ... about 107 exponentially growing cells were pulse-labelled with 5-Bromo-2’-deoxyuridine (BrdU, Sigma-Aldrich #B9285) for 1 h and sorted into four S-phase fractions ...
-
bioRxiv - Cell Biology 2023Quote: ... the DNA was stained with 5 μg/ml 4′,6-diamidino-2-phenylindole (DAPI, D9542-5MG, SIGMA) diluted in 2% bovine serum albumin (BSA ...
-
bioRxiv - Cell Biology 2023Quote: ... and (+−)-6-hydroxy-2,5,7,8-tetra-methylchromane-2-carboxylic acid (Trolox) (cat: 238813-5 G) were ordered from Sigma. Sodium hydroxide (cat ...