Labshake search
Citations for Millipore Sigma :
1201 - 1250 of 10000+ citations for 5 Chloro 1 vinyl 2 pyridone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... for 3.5 minutes at 5 μL/min with 2% Acetonitrile MS grade (Sigma Aldrich, Cat# 1207802), 0.1% formic acid (FA ...
-
bioRxiv - Microbiology 2020Quote: ... For this, NHS-CF555 (5 µl, 2 mM) in dimethyl sulfoxide (DMSO; Sigma-Aldrich Co., LLC) was added to AgNP (500 µl) ...
-
bioRxiv - Biochemistry 2020Quote: ... The sequence of the biotinylated 2’-deoxyoligonucleotide is 5’ – (Biotin) AAATGGTGCCGAAACCCGGGATCGAACCAGGGT – 3’ (Sigma Aldrich, Munich, Germany)
-
bioRxiv - Microbiology 2020Quote: ... Senescence was induced by treating cells with 100 µM 5-Bromo-2’-deoxyuridine (Sigma Aldrich, USA) for 48 hours ...
-
bioRxiv - Systems Biology 2021Quote: ... the proteins the samples were reduced with 5 mM Tris(2-carboxyethyl)phosphine (TCEP; Sigma-Aldrich) for 20 minutes in 37 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10 µM of 5’heyxynyl-dT50 (IDT) were mixed with 2 mM of CuSO4 (SIGMA, C1297) and DDW ...
-
bioRxiv - Microbiology 2022Quote: ... Blocking was performed at room temperature for 2 hours using 5% skimmed milk (70166, Sigma-Aldrich) in 1X PBS containing 0.05% Tween 20 (P1379 ...
-
bioRxiv - Immunology 2022Quote: Neonatal and juvenile mice received daily intraperitoneal injections of 5-aza-2’-deoxycytidine (decitabine, DAC; Sigma) 1 mg/kg (7 ...
-
bioRxiv - Genetics 2020Quote: ... Animals were then placed on NGM plates containing 10 µM 5-Fluoro-2′-deoxyuridine (FUDR, Sigma) to inhibit the development of progeny ...
-
bioRxiv - Cell Biology 2021Quote: ... worms were subsequently mounted on 2% agarose pads and anesthetized with 5 mM tetramisole (Sigma-Aldrich) for observation under a fluorescence microscope.
-
bioRxiv - Immunology 2020Quote: Mice were injected intraperitoneally with 0.5 mg 5-ethynyl-2’-deoxyuridine (EdU, Invitrogen or Sigma-Aldrich). For pulse experiments ...
-
bioRxiv - Microbiology 2021Quote: ... MNZ (5 uM for 24 hrs) or GSNO (350 μM for 2 hrs) (Sigma-Aldrich, USA) was determined by the eosin dye exclusion method [31].
-
bioRxiv - Neuroscience 2022Quote: ... samples were incubated for 5 min with a 4’,6-diamidino-2-phenylindole (DAPI) solution (Sigma) to stain cell nuclei ...
-
bioRxiv - Cell Biology 2023Quote: ... RPMI media containing 5% FBS and 2% w/v bovine serum albumin (BSA; Sigma-Aldrich #A6003). FA mixtures were gently rocked for 1 hour at 37°C to aid conjugation of the fatty acids to BSA ...
-
bioRxiv - Cell Biology 2023Quote: ... Bottom coverslips are activated with a 2% 3-Aminopropyltrimethoxysilane (3-APTMS) (Sigma Aldrich 13822-56-5) in 96% ethanol solution for 5 minutes and washed with 70% ethanol ...
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3 μg/mL 5-fluoro-2′-deoxyuridine + 7 μg/mL uridine (FRDU, F0503, Sigma-Aldrich). Cultured cells were then kept at 37°C and 5% CO2 in an incubator with culture media changes at 48 hours with supplemented media and NGF and FRDU until further experimentation.
-
bioRxiv - Immunology 2023Quote: ... after treatment for 2 h at 37°C with 5 μg/ml brefeldin A (Sigma-Aldrich). Cells were washed and fixed with BD cell fix diluted 4X in PBS ...
-
bioRxiv - Neuroscience 2024Quote: A mix of endotoxin-free plasmid preparation (2-5 mg/mL) and 0.5% Fast Green (Sigma) mixture was injected using a Picospritzer III (Parker ...
-
bioRxiv - Neuroscience 2023Quote: ... we injected 5-bromo-2′-deoxyuridine (BrdU, 10 mg/ml in saline, 100 mg/kg, Sigma) through an intraperitoneal (i.p. ...
-
bioRxiv - Immunology 2023Quote: ... inactive dephosphorylated A3 (2’,5’-A3) 53 or with poly(I):poly(C) (Millipore Sigma, #528906) at the concentrations indicated in figure legends with Lipofectamine 2000 (Invivogen ...
-
bioRxiv - Physiology 2024Quote: ... samples were incubated with 5 µg/mL 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI, Sigma-Aldrich) in PBS ...
-
bioRxiv - Microbiology 2023Quote: ... the parasites were selected with 10 μM 5-fluoro-2-deoxyuridine (FUDR) (Sigma–Aldrich, Cat#F0503) for three passages ...
-
bioRxiv - Microbiology 2023Quote: ... 120mM Tris HCl pH=6.8 and 20% glycerol(v/v)) containing 5% 2-mercaptoethanol (Sigma-Aldrich). Samples were resolved on a 10% SDS-PAGE gel in 1 × Tris glycine SDS buffer ...
-
bioRxiv - Microbiology 2024Quote: ... 3-(2pyridyl)-5,6-bis(2-(5-furylsulfonic acid))-1,2,4-triazin (Sigma-Aldrich, St Louis, MO, USA) (27) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Ethylene glycol-bis(2-aminoethylether)-N,N,N′,N′-tetraacetic acid (EGTA) 5 mM (Sigma E3889) was added to quench the reaction ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli were also grown in 2 mL Overnight Express Instant TB media (Sigma Aldrich, 71491-5) with added 100 μg/mL ampicillin ...
-
bioRxiv - Bioengineering 2022Quote: ... cells were incubated for 2 h at 37 °C and 5% CO2 with MTT (Sigma-Aldrich) dissolved in DMEM media without phenol red ...
-
bioRxiv - Developmental Biology 2023Quote: ... predicted mature peptide regions of ZmRALF1/2/3/5 genes were cloned into plasmid pET32b (Novagen) with gene specific primers as indicated (Supplemental Table S1) ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 5 min and blocked with PBS containing 2% FBS and 0.05% Tween20 (Sigma Aldrich, France) for 1h ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5 mL of the single cell suspension was then overlayed on 2 mL 30 % Percoll (Sigma) and centrifuged with disabled break at 600g for 8 minutes at 4 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... Rock inhibitor was withdrawn and cell selection was started with (2–5 μg/mL) puromycin(Sigma). From day 3 to day 8 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and anti-mitotic reagents (20 μM 5-fluoro-2-deoxyuridine and 20 μM uridine; Sigma Aldrich). A total of 10,000 cells were seeded into 12-well plate pre-coated with 100 μg/ml poly-D-lysine (Sigma Aldrich ...
-
bioRxiv - Systems Biology 2024Quote: ... before being transferred to auxin plates supplemented with 5-Fluoro-2’-deoxyuridine (FUDR, Sigma-Aldrich, F0503) at a final concentration of 40 µM ...
-
bioRxiv - Developmental Biology 2024Quote: ... Then the samples were immersed in 5% (V/V) H2O2 for 2 h (Sigma-Aldrich, H1009) for bleaching 35.
-
bioRxiv - Biophysics 2024Quote: P.69T and variants (5 μM each) were digested with 2 μg/ml proteinase K (Sigma) for 24 h at room temperature in 50 mM TrisHCl pH8.8 ...
-
bioRxiv - Cell Biology 2024Quote: ... and reduced with 5 mM tris(2-carboxyethyl)phosphine hydrochloride (TCEP, Sigma-Aldrich Cat No: C4706) for 30 minutes at room temperature ...
-
bioRxiv - Developmental Biology 2024Quote: ... rinsed again for 2 minutes then incubated 5 minutes in aqueous eosin Y (Sigma-Aldrich, HT110232). Sections were dehydrated then mounted with EuKitt (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2021Quote: All reactions were performed in Ub-AMC assay buffer (50 mM Tris-HCl [pH 7.5], 1 mM EDTA, 1 mM ATP, 5 mM MgCl2, 1 mM DTT, and 1 mg/mL ovalbumin [Sigma]), with a final reaction vol of 20 μL per assay in a 384-well plate (Corning) ...
-
bioRxiv - Molecular Biology 2020Quote: ... IGF-1 (100 ng ml-1) and 2DG (5 mM, Cat#D6134, Sigma Aldrich) were diluted in differentiation medium ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were blocked in 5% BSA and .1% Triton for 1 hour (Sigma-Aldrich), stained in primary antibody overnight at 4 degrees and washed with PBS-T (3x 10 mins) ...
-
bioRxiv - Microbiology 2023Quote: ... Cell-laden filters were suspended in 2-ml bead beater tubes (SSIbio, # 21276) containing 1 ml of fresh metabolite extraction solvent (2:2:1 ratio of acetonitrile (Sigma-Aldrich, # 900667), methanol (>99.8%) ...
-
bioRxiv - Neuroscience 2024Quote: ... the samples were incubated with fluorescent dye-conjugated secondary antibodies at RT for 2 hours with 1% NDS in PBST with 4’,6-diamidino-2-phenylindole (DAPI, 1:1000, Sigma-Aldrich, D9542). Afterward ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-DSCR1/RCAN1.4 (1:500, 5% milk, #D6694, Sigma-Aldrich), anti-pSer240/244-RPS6 (1:1000 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 1 μl of 5 mg/ml Catalase (Sigma-Aldrich). Imaging was performed using the Nikon set-up described above using the seam cells closest to the objective lens as homing coordinates to acquire 17 Z-stack slices with a step of 0.8 μm for each of the DAPI ...
-
bioRxiv - Genetics 2021Quote: ... 1?nM 3,3′,5-Triiodo-L-thyronine (Sigma-Aldrich, T6397), 1?×?GlutaMax (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... at 1:500 dilution in 5 % BSA (Sigma-Aldrich, a9647), anti-E1β (Abcam ...
-
bioRxiv - Neuroscience 2021Quote: ... D and 5 U mL-1 DNase I (Sigma Aldrich) at 37°C for 30 min ...
-
bioRxiv - Systems Biology 2021Quote: ... 5 g l−1 ammonium sulfate (Sigma-Aldrich Co., Germany), and 20 g l−1 D-glucose (Sigma-Aldrich Co. ...
-
bioRxiv - Biophysics 2021Quote: ... and 5 mM Trolox (CAS 53188-07-1, Sigma-Aldrich)) ...