Labshake search
Citations for Millipore Sigma :
1051 - 1100 of 10000+ citations for 6 Methyl benzo 1 3 dioxole 5 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Tubulin [B-5-1-2] (Sigma, 1:5000), HSP60 [LK1] (Thermo Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... 5 g L−1 1-butanol (Sigma-Aldrich), 5 g L−1 hexanol (Sigma-Aldrich) ...
-
Identification and biochemical characterization of a novel eukaryotic-like Ser/Thr kinase in E. colibioRxiv - Microbiology 2020Quote: ... at a final concentration of 80μg/ml and 6-chloro-3-indolyl-β-D-galactoside (Red-Gal) (Sigma) at a final concentration of 100 μg/ml as indicators ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 6 mg RBD protein in 3 mL PBS were mixed with equal-volume Freund’s incomplete adjuvant (Sigma-Aldrich) for the first boosting ...
-
bioRxiv - Developmental Biology 2022Quote: ... 0.5 μM RA treatments on days 0 and 4 plus 10 nM BIO (6-Bromoindirubin-3’-oxime, Sigma) treatment on day 0 ...
-
bioRxiv - Microbiology 2022Quote: ... female 3–4-week-old BALB/c or C57BL/6 mice were injected intraperitoneally with 10mg azoxymethane (Sigma) per kg mouse weight ...
-
bioRxiv - Neuroscience 2023Quote: Five-month-old C57BL/6 mice (13/group; 10 male and 3 female) were administered dexamethasone (D2915, Sigma; 5mg/kg per day ...
-
bioRxiv - Biochemistry 2023Quote: ... The column was eluted using 6 mL of Strep-start buffer supplemented with 3 mM d-Desthiobiotin (Sigma). The elution was diluted with 20 mL of ion-exchange buffer (25 mM HEPES-NaOH pH 7.5 ...
-
bioRxiv - Molecular Biology 2024Quote: ... A 100 mg tablet of 2,2′-Azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS, Sigma A9941) was dissolved in 100 mL of citrate buffer (50 mM ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.12 g (6.25 mmol) of 1-ethyl-3-(3-dimethyllaminopropyl) carbodiimide HCl (Sigma Aldrich) was added to the flask containing 0.98 g (2.7 mmol ...
-
bioRxiv - Immunology 2022Quote: ... containing 0.25% with 3-[(3-cholamidopropyl) dimethylammonio]-1-propanesulfonate (CHAPS) (Sigma, St. Louis, MO) for two minutes at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 98% EDC [1-(3-Dimethylaminopropyl)-3-ethyl carbodiimide hydrochloride] were purchased from Sigma Aldrich. SYBR Safe nucleic acid gel staining dye was obtained from Invitrogen (Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... 4% 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate hydrate (CHAPS; Sigma-Aldrich, Cat. No. 226947)] ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 x 90 min) in 3% PBT (3% Triton-X-100 [CAS: 9002-93-1, Sigma Aldrich] in PBS) on ice ...
-
bioRxiv - Developmental Biology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI, 1:10,000 dilution, Sigma-Aldrich), mounted in 60% glycerol ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and 4′6-diamidino-2-phenylindole (1:5000, Sigma Aldrich). Images were acquired on a Leica DM5500B microscope equipped with a Leica DEC500 camera.
-
bioRxiv - Developmental Biology 2021Quote: ... acetylated tubulin (6-11B, 1:200, Sigma Aldrich ref. T6793) primary antibodies ...
-
bioRxiv - Cell Biology 2022Quote: ... 1×106-6×106 Cells were digested by Accuatse (Sigma) for 5 min at 37 °C and resuspended in 30% matrigel (Corning ...
-
bioRxiv - Cell Biology 2019Quote: ... and mouse anti-acetylated tubulin (6-11B-1; Sigma-Aldrich) at 1:200 ...
-
bioRxiv - Bioengineering 2020Quote: ... and 1 mg/ml 6-aminocaproic acid (ACA, Sigma-Aldrich).
-
bioRxiv - Cell Biology 2022Quote: ... and acetylated-α-tubulin (mAb 6-11B-1, Sigma-Aldrich) were commercially bought ...
-
bioRxiv - Bioengineering 2022Quote: ... and 1 mg/ml 6-aminocaproic acid (ACA, Sigma-Aldrich).
-
bioRxiv - Developmental Biology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI, 1:10,000 dilution, Sigma-Aldrich). Images were obtained on a Nikon Eclipse Ti-U inverted fluorescent microscope (Nikon Instruments ...
-
bioRxiv - Neuroscience 2021Quote: ... mouse anti-GS (MAB302, clone GS-6, Millipore, 1:1000), mouse anti-NeuN (MAB377 ...
-
bioRxiv - Cell Biology 2019Quote: ... and acetylated-α-tubulin (1:5000; Sigma 6-11-B1). Conjugated secondary antibodies were purchased from Invitrogen Life Technologies (Carlsbad ...
-
bioRxiv - Cell Biology 2021Quote: ... acetylated α-tubulin (mAb 6-11B-1 T6793; Sigma-Aldrich;), S tag (EMD Millipore ...
-
bioRxiv - Neuroscience 2021Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, 1:200; Sigma Aldrich) was used ...
-
bioRxiv - Microbiology 2021Quote: ... 2019-nCoV_N1 Probe (6-FAM / BHQ-1) ACCCCGCATTACGTTTGGTGGACC (Sigma Aldrich) for amplifying RNA from the SARS CoV-2 N-1 gene ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 4′6-diamidino-2-phenylindole (1:5000, Sigma Aldrich). Images were acquired on a Leica DM5500 microscope equipped with a Leica DEC500 camera.
-
bioRxiv - Microbiology 2022Quote: ... 6 mL of 1% crystal violet (CV) solution (Sigma-Aldrich) was added to the well and incubated for 15 min at 25 °C ...
-
bioRxiv - Neuroscience 2022Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI; 1:1000; Sigma) for nuclei counterstaining ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primary antibodies used included acetylated tubulin (6-11B-1, Sigma), MmIFT27 (33 ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino-2-phenylindole (DAPI, 1 μg/ml, Sigma-Aldrich), washed twice with PBS and mounted with Vectashield mounting medium (Vector Laboratories) ...
-
bioRxiv - Bioengineering 2023Quote: ... 6-diamidino-2-phenylindole (DAPI) (Sigma Aldrich, 10236276001, 1:1000) in 0.1 M PBS for 15 min followed by a single wash for 10 min in 0.1 M PBS ...
-
bioRxiv - Developmental Biology 2023Quote: ... 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI) (1:1000; Sigma) was used as nuclear counterstaining ...
-
bioRxiv - Microbiology 2023Quote: ... 4′,6-diamidino-2-phenylindole (DAPI; 1:1000; Sigma-Aldrich) was used for nuclei staining and added to the secondary antibody solution ...
-
bioRxiv - Molecular Biology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI, Sigma Aldrich, D9542; 1:5000) and sections were mounted using an aqueous mounting medium ...
-
bioRxiv - Physiology 2022Quote: ... methyl α-D-glucopyranoside (both from Sigma-Aldrich, Saint Luis, MI, USA) were added to the extraction buffer ...
-
bioRxiv - Neuroscience 2021Quote: ... Compounds used in these studies included N-methyl-D-aspartate (NMDA; Sigma; 1.5 ul at concentration of 100mM in PBS) ...
-
bioRxiv - Genetics 2019Quote: ... we prepared a 36 mM alpha methyl tyrosine (L-AMPT) (Sigma Aldrich) diet ...
-
Mechanisms of Coupling between Angiotensin Converting Enzyme 2 and Nicotinic Acetylcholine ReceptorsbioRxiv - Neuroscience 2021Quote: ... 15 mM methyl-β-cyclodextrin (MβCD; Sigma Chemical, St. Louis, MO, USA), 5 μM cytochalasin B (CytoB ...
-
bioRxiv - Biophysics 2021Quote: ... 0.2% (v/v) methyl cellulose (M0512, Sigma-Aldrich Chemie B.V., the Netherlands), 75 mM KCl ...
-
bioRxiv - Microbiology 2021Quote: ... and motility medium with MeAsp (α-methyl-DL-aspartate; Sigma-Aldrich M6001) at concentrations of 0–460 μM in the right channel ...
-
bioRxiv - Neuroscience 2020Quote: ... cleared in methyl salicylate (35 min; M-2047; Sigma Aldrich, Steinheim, Germany) and mounted in Permount (Fisher Scientific ...
-
bioRxiv - Biophysics 2020Quote: ... and 2% (w/v) N,N-methyl-bis-acrylamide (Sigma-Aldrich, M1533) were mixed in PBS on ice and vortexed carefully ...
-
bioRxiv - Bioengineering 2022Quote: ... then immersed in propylene glycol methyl ether acetate (PGMEA, Sigma Aldrich, 484431) for 5 minutes to dissolve un-crosslinked photoresist ...
-
bioRxiv - Neuroscience 2022Quote: Methyl-tert-butyl-ether (MTBE) and chloroform were purchased from Sigma Aldrich; methanol was from Fisher Science Education ...
-
bioRxiv - Neuroscience 2022Quote: ... 40 μl of N-Methyl-N- (trimethylsilyl)trifluoroacetamide (MSTFA; 69478, Millipore Sigma) was added and the vial placed in a Benchmark Multi-Therm heat shaker set at 40°C and 250 rpm ...
-
bioRxiv - Systems Biology 2019Quote: ... Methyl methacrylate contains hydroquinone as stabilizer (Sigma-Alderich, CAS. 1310-73-2)
-
bioRxiv - Neuroscience 2020Quote: Fluorescent cationic probe tetramethylrhodamine methyl ester (TMRM) (Sigma-Aldrich, St Louis, USA) was used to evaluate the ΔΨ ...