Labshake search
Citations for Millipore Sigma :
951 - 1000 of 10000+ citations for 6 Methyl benzo 1 3 dioxole 5 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... and treatments including methyl-β-cyclodextrin-cholesterol mixture (5µg/ml, Sigma; hereafter referred to as cholesterol treatment) ...
-
bioRxiv - Microbiology 2023Quote: ... and methyl tert-Butyl ether (MTBE) were purchased from Sigma-Aldrich Chemie NV (Zwijndrecht ...
-
bioRxiv - Bioengineering 2024Quote: ... and [6,6]-Phenyl C61 butyric acid methyl ester (PCBM, Sigma-Aldrich) were diluted to 45 mg/mL and mixed (1:1 volume ratio ...
-
bioRxiv - Genomics 2024Quote: ... we embedded the dehydrated femurs or vertebrates in methyl methacrylate (Sigma) to prepare resin blocks ...
-
bioRxiv - Plant Biology 2020Quote: ... followed by 80 µl of MSTFA (N-methyl-N- (trimethylsilyl) trifluoroacetamine) and 20 µl of FAME mix (Sigma, 1 µg. µl-1 in hexane) at 30°C for 30 min.
-
bioRxiv - Biochemistry 2021Quote: ... 1.7 g (8.9 mmol) 1-ethyl-3-(3- dimethylaminopropyl)carbodiimide (EDAC, Sigma Aldrich), and 1.2 g (8.9 mmol ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC, 0.1 mg/ml, Sigma-Aldrich). Gels were rinsed 3 times with milli-Q water and dried in the oven for 15 min at 60 °C ...
-
bioRxiv - Immunology 2020Quote: ... containing 0.25% 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS) (Sigma, St. Louis, MO) for two minutes at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... GluR2/3: Anti-Glutamate Receptor 2 & 3 antibody (1:500, Millipore, Cat# AB1506). c-Fos ...
-
bioRxiv - Bioengineering 2023Quote: ... followed by 1-ethyl-3-(3-dimethylami-nopropyl)-carbodiimide hydrochloride (EDC; Sigma-Aldrich) were added drop-wise at 5000 molar equivalents to the alginate solution while stirring ...
-
bioRxiv - Biophysics 2023Quote: ... and 1-[3-(dimethylamino)propyl]-3-ethylcarbodiimide (EDC) were purchased from Sigma Aldrich Corp ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-α-tubulin (B-5-1-2) (1:10000; Sigma-Aldrich T5168, B-5-1-2), mouse anti-GAPDH (1:25000 ...
-
Interactions with stromal cells promote a more oxidized cancer cell redox state in pancreatic tumorsbioRxiv - Cancer Biology 2020Quote: ... and incubated at 37° C for 90 minutes followed by addition of 20μL N–methyl–N–(tert–butyldimethylsilyl)trifluoroacetamide + 1% tert–Butyldimethylchlorosilane (Sigma 375934) and incubated at 60°C for 1 hour ...
-
bioRxiv - Cancer Biology 2020Quote: ... and incubated at 37°C for 90 minutes followed by addition of 20µL N–methyl–N–(tert–butyldimethylsilyl)trifluoroacetamide + 1% tert– Butyldimethylchlorosilane (Sigma 375934) and incubated at 60°C for 1 hour ...
-
bioRxiv - Biochemistry 2022Quote: ... Blocking Buffer (100 mM HEPES, pH 7.5 [Gibco], 1 mM EDTA [Sigma-Aldrich], 2.5% SDS [Sigma-Aldrich], 0.1% S-methyl methanethiosulfonate [Sigma-Aldrich]), Binding Buffer (100 mM HEPES ...
-
bioRxiv - Bioengineering 2022Quote: ... ALP activity in cell lysates was determined by adding 20 μl of 0.75 M 2-amino-2-methyl-1-propanol (A65182, Sigma-Aldrich) to 80 μl sample in 96-wells assay plates ...
-
bioRxiv - Cell Biology 2022Quote: A solution of methimazole (1-methyl-3H-imidazole-2-thione) (CAS 60-56-0; MW, 114.17 g/mol; purity, ≥99%; Sigma-Aldrich) was used to induce hypothyroidism ...
-
bioRxiv - Immunology 2022Quote: ... ALP activity was determined by adding 20 μl of 0.75 M 2-amino-2-methyl-1-propanol (A65182, Sigma-Aldrich) to 80 μl sample in 96-wells assay plates ...
-
bioRxiv - Neuroscience 2019Quote: ... and 0.1 g of odorant consisting of one of three different concentrations (0.1%, 1%, and 2% by weight) of methyl salicylate (Sigma-Aldrich) diluted in mineral oil (Fisher Chemical Paraffin Oil ...
-
bioRxiv - Neuroscience 2021Quote: The following odors/concentrations were used for comparing molecular properties to receptor responses: 1% 2-methyl-2-pentenal (Sigma 294667), 1% trans-cinnamaldehyde (Sigma C80687) ...
-
bioRxiv - Bioengineering 2022Quote: ... ALP activity in cell lysates was determined by adding 20 μl of 0.75 M 2-amino-2-methyl-1-propanol (A65182, Sigma-Aldrich) to 80 μl sample in 96-wells assay plates ...
-
bioRxiv - Bioengineering 2022Quote: ... 80 μL of the supernatant was mixed with 20 μL of 0.75M 2-amino-2-methyl-1-propanol buffer (A65182, Sigma-Aldrich) and 100 μL 100 mM p-nitrophenylphosphate solution (71768 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The samples were then further incubated with 20 µL of N-(tert-butyldimethylsilyl)-N-methyl-trifluoroacetamide with 1% tert-Butyldimethylchlorosilane (TBDMS) (Sigma) at 60 °C for 60 min ...
-
Polarized Mechanosensitive Signaling Domains Protect Arterial Endothelial Cells Against InflammationbioRxiv - Cell Biology 2023Quote: Visualization of the accessible pool of cholesterol was performed after 30 min treatment with 10 mM methyl-beta-cyclodextrin (MβCB) in 1% lipoprotein-deficient serum (LPDS, Sigma #S5519) or 1% LPDS control ...
-
bioRxiv - Cell Biology 2023Quote: ... The samples were treated with 1 ml pre-cooled (-20°C) mixture of methyl tert-butyl ether (MTBE, Sigma 306975), Optima LC-MS grade methanol (A456-212 ...
-
bioRxiv - Cell Biology 2023Quote: ... The samples were treated with 1 ml pre-cooled (-20°C) mixture of methyl tert-butyl ether (MTBE, Sigma 306975), Optima LC-MS grade methanol (A456-212 ...
-
bioRxiv - Plant Biology 2024Quote: ... The tissue was blotted on tissue paper before weighing to remove excess water and then was transferred into a 1.5mL Eppendorf tube containing 1 mL of di-methyl sulfoxide (DMSO) (#D8418, Sigma Aldrich) and incubated in the dark at 65C with 300 rpm shaking for 45 minutes ...
-
bioRxiv - Cell Biology 2019Quote: ... all coverslips were incubated with a 5% 3-aminopropyltrimethoxysilane solution (281778, Sigma-Aldrich) in water for 30 minutes ...
-
bioRxiv - Developmental Biology 2020Quote: ... 3-5 colonies were picked and incubated in 2mL Terrific Broth (T0918, Sigma) containing 100µg/mL Ampicillin for 8 hours ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5-Bromo-4-chloro-3-indolyl phosphate-toluoidine were from Sigma-Aldrich, St ...
-
bioRxiv - Neuroscience 2020Quote: ... TodoNeo1: 5’–CCG CTT TTC TGG ATT CAT CGA C–3’from SIGMA life science) ...
-
bioRxiv - Microbiology 2019Quote: ... for 5 min at 14,000 rpm at 4°C (Sigma 3-KIS centrifuge). Samples were snap-frozen in liquid N2 and delipidated by protein precipitation based on the protocol of Wessel and Flügge (61) ...
-
bioRxiv - Biochemistry 2022Quote: ... or 100nM of synthetic RNA [45-mer: 5′ GGGUCAACGUGGGCAAAGAUGUCCUAGCAAGCCAGAAUUCGGCAG −3′] generated by Sigma. In reactions where CifA was co-present with CifB ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1µl of each primer (10µm, 5’: FAATGGCAGAGTGGGGTTGGG, 3’: CGGCAAACGGACAGAAGCATT, Sigma-Aldrich, USA).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Membranes were washed 3×5 min with 0.1% Tween® 20 (Sigma-Aldrich) in TBS before a 1 hour incubation with a 1:5,000 dilution of sheep anti-mouse IgG horseradish perodixase secondary antibody (GE Healthcare ...
-
bioRxiv - Microbiology 2021Quote: ... The probe used was as follows: 5’[6FAM]AGACTAATTCTCCTCGGCGGGCACG[TAM]3’ (Sigma Aldrich). Analysis was performed using the Rotor-Gene 6000 Series Software 1.7 (Corbett Life Sciences ...
-
bioRxiv - Immunology 2021Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (Sigma-Aldrich). Air-dried plates were read ...
-
bioRxiv - Neuroscience 2022Quote: ... and laminin for 3 hours at 37°C (5 μg/mL, Sigma L2020). To create single cell suspensions for plating aNSCs ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 dpf larvae were exposed to 3 μM CuSO4 (Sigma-Aldrich, Cat# 451677) diluted in EM in cell strainers (Corning ...
-
bioRxiv - Neuroscience 2022Quote: ... incubated in blocking solution (3% skimmed milk or 5% BSA (Sigma-Aldrich, A9647) in TBS + 0.01% Tween20 (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.1 mM 8-bromoadenosine 3′,5′ cyclic monophosphate sodium salt (Sigma-Aldrich; “C”), and 0.1 mM 3-isobutyl-1-methylxanthine (IBMX ...
-
bioRxiv - Neuroscience 2023Quote: ... 3-(4,5-dimethylthiazol-2-Yl)-Diphenyltetrazolium Bromide (MTT, CT01-5, Sigma-Aldrich, UK) stock solution was diluted in F12 medium without phenol red (1:5) ...
-
bioRxiv - Genetics 2023Quote: ... beads were washed 3 times 5 minutes with lysis buffer (Sigma-Aldrich, L3412) on a rotator and protease and phosphatase inhibitors ...
-
bioRxiv - Cell Biology 2020Quote: ... 5-Fluorouridine (1 mM) (Sigma) was added in the culture media 15 min before fixation ...
-
bioRxiv - Neuroscience 2021Quote: ... α5 (1:250, Millipore #AB9678), β3 (1:250 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cordycepin was added to the 3’ end of in vitro transcribed mRNA by substituting 50 mM Cordycepin (3’-deoxyadenosine) 5’-triphosphate sodium salt (Sigma-Aldrich) in 10 mM Tris pH7 for ATP in a poly(A)-tailing reaction with a Poly(A ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 x 10 min 100% EtOH) and cleared (3 x 5 min) in xylene (247642, CAS: 1330-20-7, Sigma Aldrich). Finally ...
-
bioRxiv - Neuroscience 2023Quote: ... a shRNA sequence based on 5’-GCCTAAATGGTCAAGGAGATA-3’ as the sense nucleotide corresponding to the 3’UTR of mouse mDia1 (NM_007858.4; Sigma-Aldrich, Cat# TRCN0000108685) was designed as an oligonucleotide with overhangs (s ...
-
bioRxiv - Biochemistry 2023Quote: ... DHEA sulfate (5-androsten-3β-ol-17-one-3-sulfate) and testosterone (4-androsten-17β-ol-3-one) were purchased from Sigma Aldrich. 11β-hydroxyandrostenedione (11β-hydroxy-4-androstene-3,17-dione) ...
-
bioRxiv - Cell Biology 2022Quote: ... Arteries were then stimulated with increasing concentrations of serotonin (5-HT, from 10 -8 to 3· 10 -5 M, Sigma), endothelium-dependent vasodilator acetylcholine (ACh ...