Labshake search
Citations for Millipore Sigma :
1301 - 1350 of 10000+ citations for 6 Methyl benzo 1 3 dioxole 5 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... the master was developed in propylene glycol methyl ether acetate (PGMEA, Sigma Aldrich). The exact height was measured by a Dektak profilometer (Bruker) ...
-
bioRxiv - Plant Biology 2023Quote: ... or methyl viologen dichloride hydrate (C12H14Cl2N2 x H2O, Sigma-Aldrich; Catalog # 856177-1G). Nine days after sowing on ½-salt strength MS medium ...
-
bioRxiv - Physiology 2023Quote: ... with scopolamine methyl bromide (0.1 mg/kg body weight; #S8502, Sigma-Aldrich, Germany) to block muscarinic receptors (PSNS) ...
-
bioRxiv - Bioengineering 2023Quote: ... NG-nitro-L-arginine methyl ester (L-NAME) (50 μM, Sigma Cat#N5751) was added 10 minutes before DMPP stimulation to observe the effects of NOS inhibition ...
-
bioRxiv - Bioengineering 2024Quote: ... poly(ethylene glycol) methyl ether acrylate [average Mn = 480 Da] (PEGA9, Sigma-Aldrich), 2,2’-Azobis(2-methylpropionitrile ...
-
bioRxiv - Cell Biology 2024Quote: ... with or without 4 mM methyl viologen dichloride hydrate (paraquat) (Sigma Cat. 856177). FuDR was used to inhibit the development of progeny ...
-
bioRxiv - Genomics 2023Quote: ... stained for 15 minutes in a methyl green solution (0.1 mM, Sigma-Aldrich) and washed twice with NaCl-HEPES ...
-
bioRxiv - Pathology 2020Quote: ... 5-azacytidine (5-aza, Sigma-Aldrich; 1 µM in 10% FCS DMEM) for 7 days according to previous publications12 ...
-
bioRxiv - Cell Biology 2020Quote: ... DAPI (4’,6-Diamidino-2-phenylindole dihydrochloride, 1:200, Sigma-Aldrich) staining was performed to visualize nuclei ...
-
bioRxiv - Genetics 2021Quote: ... and 1 unit/ml glucose-6-phosphate dehydrogenase (G6PDH; Sigma Aldrich). Reactions were stopped after 0 and 1 hr using 100 µl acetonitrile and further stirred for an additional 30 min ...
-
bioRxiv - Bioengineering 2019Quote: ... together with 4’,6-diamidino-2-phenylindole (DAPI, 1:500, Sigma) for localization of cell nuclei ...
-
bioRxiv - Biophysics 2020Quote: ... DAPI (4′,6-diamidino-2-phenylindole dihydrochloride, Sigma, 1:500 dilution) was applied for 30 min followed by washes in PBS (3 × 10 sec) ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 Trolox® (6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid, Sigma) and 10 HEPES (250 mOsm ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and 6 μL of DNase I (20 mg mL-1, Sigma). Cells were lysed via sonication (5 s on and 5 s off for 2.5 min ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-G-6-PDH diluted 1:20000 (Sigma, Cat. No: A9521) and anti AcLys diluted 1:1000 (Cell Signalling ...
-
bioRxiv - Bioengineering 2020Quote: ... and 1:1000 4’,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich), for 3h ...
-
bioRxiv - Cell Biology 2021Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, 1:200, Sigma-Aldrich) in the dark for 30 min at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... Tubes were underlaid with 1 ml Histopaque (Sigma, 10771-6×100ML) using a Pasteur pipette ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 1 unit/ml glucose-6-phosphate dehydrogenase (G6PDH-Sigma Aldrich). Reactions were incubated at 30 °C ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-vimentin (1:100, Sigma-Aldrich clone LN-6 MAB1681), rabbit anti-nuclear factor IA (NFIA ...
-
bioRxiv - Cell Biology 2023Quote: ... and 4',6-Diamidino-2-phenylindole (DAPI, Sigma, D9542, 1:1000). After incubation with secondary antibodies ...
-
bioRxiv - Neuroscience 2023Quote: ... incubated with 4′,6-diamidino-2-phenylindol (DAPI, Millipore, 1:5000) for 5 min ...
-
bioRxiv - Neuroscience 2023Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, 1:1000; Sigma-Aldrich) at room temperature for 2 hours ...
-
bioRxiv - Immunology 2023Quote: ... Mouse Monoclonal anti-mouse Glutamin Synthetase (GS-6, 1:250, Millipore), Rabbit Polyclonal anti-SDS (PA5-58704) ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino-2-phenylindole (DAPI; D9542-10MG, 1:10000; Sigma-Aldrich) in PBS for 20 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino-2-phenylindole (DAPI; D9542-10MG, 1:10000; Sigma-Aldrich) in PBS for 20 minutes ...
-
bioRxiv - Physiology 2022Quote: ... 3051.2) for 5 min and blocked in PBS containing 3% bovine serum albumin and 1% normal goat serum (Sigma-Aldrich, Taufkirchen, Germany, A4503 & G0023) at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... des-Arg9-Leu8]-BK (B1R antagonist) and 3-(5′-Hydroxymethyl-2′-furyl)-1-benzyl indazole were purchased from Sigma-Aldrich (St. Louis, MO, USA). 8-Bromoguanosine 3′ ...
-
bioRxiv - Bioengineering 2024Quote: ... for 1-3 hours at room temperature (RT) and then permeabilized with 0.1% (v/v) Triton X-100 (Sigma-Aldrich, Cat # 9036-19-5) for 1 hour before blocking with 3% (w/v ...
-
bioRxiv - Neuroscience 2020Quote: 6-hydoxydopamine (6-OHDA) solution was freshly prepared by adding 6-OHDA HCl (Sigma) to an appropriate volume of sterile saline (0.9% NaCl ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and blocked for 1-hr with 3% Normal Bovine serum in TBS containing 3% triton-X-100 (TBST, CAS-9002-93-1, Sigma, USA). Following blocking ...
-
bioRxiv - Bioengineering 2023Quote: ... (1) A modification solution was made by dissolving 10 mM of 1-Ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC, Sigma-Aldrich Inc.) and 75 mM of N-hydroxysuccinimide (NHS ...
-
bioRxiv - Bioengineering 2021Quote: ... 6-aminocapuroic acid (6-AA, A2504, Sigma-Aldrich), trans-4-(aminomethyl ...
-
bioRxiv - Molecular Biology 2022Quote: ... with 6-Thioguanine (6-TG, Sigma-Aldrich A4660) starting day 7 post-transfection to select for the loss of Hprt and with 1 μM ganciclovir (GCV ...
-
bioRxiv - Neuroscience 2022Quote: ... 6-hydroxydopamine (6-OHDA; cat #: 162957; Sigma-Aldrich) was injected similarly into the right striatum ipsilateral to the virus injection ...
-
bioRxiv - Plant Biology 2019Quote: 6-Benzylaminopurine (6-BAP) powder from Sigma Aldrich was first dissolved in 10 drops of 1 N NaOH ...
-
bioRxiv - Genomics 2019Quote: ... 6-azido-6-deoxy-D-glucose (Sigma 712760) Biotin azide (Thermo Fisher B10184) ...
-
bioRxiv - Neuroscience 2023Quote: 6-OHDA (6-hydroxydopamine hydrobromide, Sigma-Aldrich, 162957) dissolved in sterile saline was injected (1 µL ...
-
bioRxiv - Cancer Biology 2021Quote: ... HsNHE9 targeting short hairpin RNA (shRNA) (5’-CCGGCCCTCCATTAAGGAGAGTTTTT CAAGAGAAAACTCTCCTTAATGGAGGTTTTTC-3’) and scramble control (Sigma-Aldrich) (5’-CAACAAGATGAAGAGCACCAA-3’ ...
-
bioRxiv - Developmental Biology 2021Quote: ... the culture medium was supplemented with 3 μM or 5 μM SU5402 (Sigma-Aldrich, SML0443) before live imaging ...
-
bioRxiv - Bioengineering 2019Quote: ... and 0.5 mM 8-Bromoadenosine 3’,5’-cyclic monophosphate (8-Br-cAMP; Sigma-Aldrich B5386) in EGM for 6 days [30–34] ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 0.5 mM 8-Bromoadenosine 3′,5′-cyclic monophosphate (8-Br-cAMP; B5386, Sigma Aldrich). After 48 hrs ...
-
bioRxiv - Molecular Biology 2020Quote: ... Stock solutions: 50 mg/ml 5-bromo-4-chloro-3-indolyl phosphate (BCIP, Sigma B8503) in 100% dimethylformamide (Sigma D4254 ...
-
The cellular basis of protease activated receptor type 2 (PAR2) evoked mechanical and affective painbioRxiv - Neuroscience 2020Quote: ... and 3 ug/ml 5-fluoro-2’-deoxyuridine + 7 ug/ml uridine (FRD+U; Sigma) added ...
-
bioRxiv - Cell Biology 2019Quote: ... or the Kv7 channel activator retigabine (10−8 M to 3·10−5 M, Sigma). Some PAs were treated with XE991 (3·10-8-3·10-6 ...
-
bioRxiv - Genomics 2020Quote: ... into 384 well plates containing 3 μl of Smart-seq3 lysis buffer (5% PEG (Sigma), 0.10% Triton X-100 (Sigma) ...
-
bioRxiv - Physiology 2020Quote: ... and 5-bromo-4-chloro-3’-indolyphosphate p-toluidine salt (BCIP; Sigma-Aldrich, Gillingham, UK) substrate solution (50 mg/ml BCIP in autoclaved water ...
-
bioRxiv - Neuroscience 2021Quote: ... A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’) was synthesized by Sigma Aldrich. The gRNA ...
-
bioRxiv - Cell Biology 2021Quote: ... Sig8-bromoadenosine 3′,5′-cyclic monophosphate sodium salt (8-Br-cAMP, Sigma-Aldrich, Darmstadt, Germany) at 0 hpi to a final concentration of 0.2 mM ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.1% Tween (Fisher)] containing either 5% non-fat milk powder or 3% BSA (Sigma-Aldrich) at room temperature for 40 minutes ...