Labshake search
Citations for Millipore Sigma :
1001 - 1050 of 10000+ citations for 6 Methyl benzo 1 3 dioxole 5 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... butylated hydroxytoluene (BHT) and methyl nonadecanoate were purchased from Sigma Aldrich, India ...
-
bioRxiv - Neuroscience 2019Quote: ... and nanoclip in propylene glycol methyl ether acetate (PGMEA; Sigma Aldrich) for 20 min ...
-
bioRxiv - Immunology 2021Quote: ... containing cryomolds and immediately frozen in 2-methyl-butane (Sigma-Aldrich). 5μm frozen sections of the tissues were made using the cryostat and layered on Superfrost™ Plus Slides (Thermo Scientific) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... or cholesterol-depleted methyl-β-cyclodextrin (MβCD; varying concentrations, Sigma Aldrich), in Hanks’ buffered saline solution (HBSS) ...
-
bioRxiv - Cell Biology 2020Quote: ... and sodium carboxy methyl cellulose were purchased from Sigma-Aldrich (USA). The glucose monitoring system ...
-
bioRxiv - Immunology 2021Quote: ... compound (Tissue-Tek) in liquid nitrogen-cooled 2-methyl butane (Sigma). Ten micron sections were melted onto PEN-membrane glass slides (Leica ...
-
bioRxiv - Developmental Biology 2020Quote: ... samples were flash-frozen in 2-methyl-butane (Sigma-Aldrich M32631) at −150°C for 1 hour ...
-
bioRxiv - Cell Biology 2022Quote: ... GSK3β inhibitor) and methyl-BIO (MBIO, control) were obtained from Millipore, and a 10 mM stock solution was prepared in DMSO ...
-
bioRxiv - Molecular Biology 2022Quote: ... followed by 4%UA/2% Methyl Cellulose (Sigma Aldrich, Gillingham, UK) at a 1:9 ratio on ice for 10 minutes ...
-
bioRxiv - Plant Biology 2022Quote: ... and methyl cis,cis-11,14-eicosenoate were purchased from Sigma Aldrich.
-
bioRxiv - Neuroscience 2022Quote: ... cleared and finally mounted in methyl salicylate (M6752, Sigma-Aldrich, France) for observation ...
-
bioRxiv - Neuroscience 2022Quote: ... frozen in 2-methyl butane (Sigma-Aldrich, St. Louis, MO, USA) over the fumes of liquid nitrogen ...
-
bioRxiv - Cancer Biology 2024Quote: Tetramethylrhodamine methyl ester perchlorate (TMRM) (Sigma Aldrich, St. Louis, MO, USA)
-
bioRxiv - Genomics 2024Quote: ... we embedded the dehydrated femurs or vertebrates in methyl methacrylate (Sigma) to prepare resin blocks ...
-
bioRxiv - Bioengineering 2024Quote: ... and [6,6]-Phenyl C61 butyric acid methyl ester (PCBM, Sigma-Aldrich) were diluted to 45 mg/mL and mixed (1:1 volume ratio ...
-
bioRxiv - Plant Biology 2023Quote: D-NMG base: N-Methyl-D-glucamine (Sigma-Aldrich, cat # 66930)
-
bioRxiv - Cell Biology 2023Quote: ... Cholesterol-methyl-β-cyclodextrin (MβCD) soluble complex (cat. #C4951, Sigma-Aldrich); TGF-β1 (cat ...
-
bioRxiv - Microbiology 2023Quote: ... and methyl tert-Butyl ether (MTBE) were purchased from Sigma-Aldrich Chemie NV (Zwijndrecht ...
-
bioRxiv - Molecular Biology 2023Quote: ... and treatments including methyl-β-cyclodextrin-cholesterol mixture (5µg/ml, Sigma; hereafter referred to as cholesterol treatment) ...
-
bioRxiv - Plant Biology 2023Quote: ... and then 70 μL of N-methyl-N-trimethylsilyltrifluoroacetamide (Sigma-Aldrich) was added to the samples and kept again at 40°C for 45 minutes ...
-
bioRxiv - Developmental Biology 2024Quote: Tg(kdrl:GFP) embryos were imaged in 2% Methyl Cellulose (Sigma M0262) on an Olympus BX61 microscope using cellSens Dimension software (Evident).
-
bioRxiv - Cell Biology 2024Quote: ... CHOL-conjugation was performed with methyl-β-cyclodextrin (MβCD, Sigma #C4555) 116 ...
-
bioRxiv - Microbiology 2024Quote: ... Purified HXA3 methyl ester (Cayman) at 10 nM and fMLP (Sigma) at 10 μM were supplemented apically as indicated ...
-
bioRxiv - Immunology 2024Quote: ... embedded in 1.7% or 2% methyl cellulose (M0512-100G, Sigma-Aldrich) and imaged in one representative focus layer with Nikon AZ100 macroscope and NIS-Elements D 5.02.00 software (Nikon ...
-
bioRxiv - Biochemistry 2021Quote: ... 1.7 g (8.9 mmol) 1-ethyl-3-(3- dimethylaminopropyl)carbodiimide (EDAC, Sigma Aldrich), and 1.2 g (8.9 mmol ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC, 0.1 mg/ml, Sigma-Aldrich). Gels were rinsed 3 times with milli-Q water and dried in the oven for 15 min at 60 °C ...
-
bioRxiv - Immunology 2020Quote: ... containing 0.25% 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS) (Sigma, St. Louis, MO) for two minutes at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... GluR2/3: Anti-Glutamate Receptor 2 & 3 antibody (1:500, Millipore, Cat# AB1506). c-Fos ...
-
bioRxiv - Biophysics 2023Quote: ... and 1-[3-(dimethylamino)propyl]-3-ethylcarbodiimide (EDC) were purchased from Sigma Aldrich Corp ...
-
bioRxiv - Immunology 2024Quote: ... 1mL of 50 mg/mL 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (Sigma) in PBS was added ...
-
bioRxiv - Plant Biology 2020Quote: ... followed by 80 µl of MSTFA (N-methyl-N- (trimethylsilyl) trifluoroacetamine) and 20 µl of FAME mix (Sigma, 1 µg. µl-1 in hexane) at 30°C for 30 min.
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-α-tubulin (B-5-1-2) (1:10000; Sigma-Aldrich T5168, B-5-1-2), mouse anti-GAPDH (1:25000 ...
-
bioRxiv - Cell Biology 2019Quote: ... all coverslips were incubated with a 5% 3-aminopropyltrimethoxysilane solution (281778, Sigma-Aldrich) in water for 30 minutes ...
-
bioRxiv - Developmental Biology 2020Quote: ... 3-5 colonies were picked and incubated in 2mL Terrific Broth (T0918, Sigma) containing 100µg/mL Ampicillin for 8 hours ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5-Bromo-4-chloro-3-indolyl phosphate-toluoidine were from Sigma-Aldrich, St ...
-
bioRxiv - Neuroscience 2020Quote: ... TodoNeo1: 5’–CCG CTT TTC TGG ATT CAT CGA C–3’from SIGMA life science) ...
-
bioRxiv - Microbiology 2019Quote: ... for 5 min at 14,000 rpm at 4°C (Sigma 3-KIS centrifuge). Samples were snap-frozen in liquid N2 and delipidated by protein precipitation based on the protocol of Wessel and Flügge (61) ...
-
bioRxiv - Biochemistry 2022Quote: ... or 100nM of synthetic RNA [45-mer: 5′ GGGUCAACGUGGGCAAAGAUGUCCUAGCAAGCCAGAAUUCGGCAG −3′] generated by Sigma. In reactions where CifA was co-present with CifB ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1µl of each primer (10µm, 5’: FAATGGCAGAGTGGGGTTGGG, 3’: CGGCAAACGGACAGAAGCATT, Sigma-Aldrich, USA).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Membranes were washed 3×5 min with 0.1% Tween® 20 (Sigma-Aldrich) in TBS before a 1 hour incubation with a 1:5,000 dilution of sheep anti-mouse IgG horseradish perodixase secondary antibody (GE Healthcare ...
-
bioRxiv - Microbiology 2021Quote: ... The probe used was as follows: 5’[6FAM]AGACTAATTCTCCTCGGCGGGCACG[TAM]3’ (Sigma Aldrich). Analysis was performed using the Rotor-Gene 6000 Series Software 1.7 (Corbett Life Sciences ...
-
bioRxiv - Immunology 2021Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (Sigma-Aldrich). Air-dried plates were read ...
-
bioRxiv - Neuroscience 2022Quote: ... and laminin for 3 hours at 37°C (5 μg/mL, Sigma L2020). To create single cell suspensions for plating aNSCs ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 dpf larvae were exposed to 3 μM CuSO4 (Sigma-Aldrich, Cat# 451677) diluted in EM in cell strainers (Corning ...
-
bioRxiv - Neuroscience 2022Quote: ... incubated in blocking solution (3% skimmed milk or 5% BSA (Sigma-Aldrich, A9647) in TBS + 0.01% Tween20 (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.1 mM 8-bromoadenosine 3′,5′ cyclic monophosphate sodium salt (Sigma-Aldrich; “C”), and 0.1 mM 3-isobutyl-1-methylxanthine (IBMX ...
-
bioRxiv - Neuroscience 2023Quote: ... 3-(4,5-dimethylthiazol-2-Yl)-Diphenyltetrazolium Bromide (MTT, CT01-5, Sigma-Aldrich, UK) stock solution was diluted in F12 medium without phenol red (1:5) ...
-
bioRxiv - Genetics 2023Quote: ... beads were washed 3 times 5 minutes with lysis buffer (Sigma-Aldrich, L3412) on a rotator and protease and phosphatase inhibitors ...
-
bioRxiv - Cell Biology 2020Quote: ... 5-Fluorouridine (1 mM) (Sigma) was added in the culture media 15 min before fixation ...
-
bioRxiv - Neuroscience 2021Quote: ... α5 (1:250, Millipore #AB9678), β3 (1:250 ...