Labshake search
Citations for Millipore Sigma :
1001 - 1050 of 1404 citations for Bordetella Pertussis Toxin Glycerol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... 631-1339) was mounted on the slide with 280µL of 85% glycerol (Sigma, 49767-100ML).
-
bioRxiv - Biochemistry 2023Quote: ... 5 mM TCEP and 5% glycerol pH 8.0) supplemented with ∼10 mg lysozyme (Sigma, L1667), 25 μl/ml BioLock biotin blocker (IBA ...
-
bioRxiv - Biochemistry 2023Quote: ... 10% glycerol and 1 mM DTT using Amicon Ultra-0.5 ml (10 kDa MWCO, Millipore) to remove x3 FLAG peptides ...
-
bioRxiv - Cell Biology 2020Quote: ... at room temperature before dissociated cells were collected and cultured in RPMI medium containing 200nM TPA and 200pM cholera toxin (RPMI+ hereafter) (both Sigma-Aldrich). At passage 0 ...
-
bioRxiv - Physiology 2021Quote: Recipient mice were rendered diabetic before islet transplantation with a single intravenous injection of the beta cell toxin streptozotocin (STZ 200 mg/Kg; Sigma, MO) dissolved fresh in 100 mM sodium citrate (pH 4.5 ...
-
bioRxiv - Cancer Biology 2021Quote: ... University of Pennsylvania) and grown in serum-free WIT-P medium (Cellaria) without antibiotics and 100ng/ml cholera toxin (Sigma-Aldrich). Quality control of all cell lines was carried out by frequent STR analysis (Eurofins MWG) ...
-
bioRxiv - Cell Biology 2022Quote: ... Collected blebs were then pelleted with a centrifugation at 16100 g for 5 min and incubated in a solution containing an exogeneous ATP regeneration system (energy mix) and alpha-toxin to permeabilise the bleb membrane (5% A-Hemolysin alphatoxin (1 mg/mL; H9395, Sigma Aldrich), 2% energy mix (50 mg/mL UTP ...
-
bioRxiv - Microbiology 2021Quote: ... followed by the incubation with fluorescein isothiocyanate (FITC)-cholera toxin B subunit (CTB; Sigma, C1655, 1: 1000 diluted in sterile PBS) for 1 hour at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... animals were sedated with ketamine (10mg/kg) and Cholera Toxin subunit B (CT-B, 10 µl, Sigma C9903, 1% aqueous (sterile)) was injected subcutaneously into the distal and middle finger pads of digits 1-3 of both hands ...
-
bioRxiv - Immunology 2022Quote: Conditional depletion of Cx3cr1+ cells was achieved by injecting MafbCre/+.Cx3cr1LSL-DTR/+ mice with 200ng Diphtheria toxin (DTx; Sigma Aldrich, D0564) in 100 μl sterile saline intraperitoneally (IP ...
-
bioRxiv - Neuroscience 2021Quote: ... We gently lowered a glass capillary (Φ = 8 μm opening) in the targeted regions and slowly injected about 30 nl cholera toxin B subunit (CTB, 1%, Sigma-Aldrich) or virus ...
-
bioRxiv - Immunology 2021Quote: ... The Dil-labelled nanocarriers were visualised using the lipophilic dye excitation wavelength of 514 nm while plasma membranes were labelled with FITC-conjugated cholera toxin (Sigma, C1655) and visualised at the excitation wavelength of 488 nm ...
-
bioRxiv - Neuroscience 2021Quote: The left caudate nucleus of one monkey (not included in the behavioral study) was infused with the retrograde tracer cholera toxin B subunit (C9903, Sigma-Aldrich) via guide cannulae ...
-
bioRxiv - Cancer Biology 2022Quote: ... KB-derived cell lines were grown in Dulbecco’s Modified Eagle Medium/Nutrient Mixture F-12 supplemented with 10% FCS and 5 µg/mL Insulin 5 ng/mL cholera toxin and 5 ng/mL murine epidermal growth-factor (EGF, Sigma, #E4127). The HEK293FT cell line (RRID ...
-
bioRxiv - Developmental Biology 2021Quote: ... Nuclepore filters were mounted using antifade mounting media containing 90% (vol/vol) glycerol (Sigma #G5516-1L) in 1xPBS with 1-4 diazobicyclo[2,2,2]octane (Sigma #D27802-100G ...
-
bioRxiv - Evolutionary Biology 2021Quote: The HIV-derived lentiviral vector pLKO.1 containing shRNAs (TRIM17 MISSION shRNA Bacterial Glycerol Stock, Sigma) that targeted Trim17 (shTrim17-1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Then reactions were mixed with 10 X loading buffer (30 % glycerol, 0.2 % Orange G; Millipore Sigma) and ran on a 3 % agarose gel in 1 X TBE on ice ...
-
bioRxiv - Biochemistry 2019Quote: ... 10 mM imidazole and 10% glycerol supplemented with 1 mg/ml chicken egg lysozyme (Sigma-Aldrich) and one EDTA-free protease inhibitor tablet (Roche ...
-
bioRxiv - Physiology 2020Quote: ... Lipolysis was assessed by measuring glycerol and free fatty acid (FFA) levels using triglyceride (Sigma-Aldrich) and non-esterified fatty acid (NEFA ...
-
bioRxiv - Microbiology 2019Quote: ... and coverslips were mounted on slides in a 90% glycerol mounting medium with 0.1% DABCO (Sigma), before imaging at 40× and 100× magnification.
-
bioRxiv - Neuroscience 2021Quote: ... the slices were mounted with DABCO-glycerol mounting medium (25 mg/ml DABCO (Sigma D27802-25G), 90% glycerol ...
-
bioRxiv - Neuroscience 2021Quote: ... washed 3 times for 15 min using 1× PTW and mounted in 87% glycerol (Sigma-Aldrich)/ddH2O containing 25 mg/ml DABCO (Roth/Lactan) ...
-
bioRxiv - Cell Biology 2021Quote: ... 10% (v/v) glycerol) containing 10 mM NEM and a protease inhibitor mix (Sigma-Aldrich, P2714)) at a density of 107 cells/ml ...
-
bioRxiv - Cancer Biology 2022Quote: ... Bacterial Glycerol Stock Sequence (same as Construct 2) 2# CCGGGCTGTTACTTTCCCAGATATTCTCGAGAATATCTGGGAAAGTAACAGCTTTTTG) constructs were purchased from Sigma Aldrich. The plasmids were packaged into Lentiviral particles using the 2rd generation packaging plasmid (Addgene) ...
-
bioRxiv - Cell Biology 2022Quote: ... 10% glycerol) using Amicon Ultra-0.5 centrifugal filter units with a 10kDa cutoff (Millipore Sigma, UFC5010). Protein concentrations were determined ...
-
bioRxiv - Physiology 2022Quote: ... Glycerol and triglyceride concentrations in blood serum were measured using the Triglyceride Determination Kit (Sigma, TR0100) following the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2020Quote: ... and 5% glycerol) and concentrated with an ultrafiltration unit using a 10-kDa cutoff membrane (Millipore). The concentrated protein was flash-frozen in liquid nitrogen and stored at -80 °C.
-
bioRxiv - Biochemistry 2020Quote: ... 10% (v/v) glycerol] with Amicon Ultra-15 50 kDa cut-off centrifugal filter units (Millipore), and frozen with liquid nitrogen and stored at – 80°C.
-
bioRxiv - Evolutionary Biology 2019Quote: ... After removing glycerol (using MultiScreen High Volume Filter Plates with 0.45 μm Durapore membrane, Millipore MVHVN4525), cell were resuspended in 500µL LB and grown overnight at 30°C without shaking in deep well plates ...
-
bioRxiv - Physiology 2021Quote: ... 1% Triton X-100 and 10% glycerol with freshly added protease and phosphatase inhibitor cocktail (Sigma). The protein concentration was determined by Bradford protein assay (Bio-Rad) ...
-
bioRxiv - Neuroscience 2022Quote: ... and NPG-glycerol mounting medium [2% (w/v) N-propyl gallate (NPG, Cat# P3130, Sigma-Aldrich), 90% (v/v ...
-
bioRxiv - Microbiology 2022Quote: ... 10% glycerol) overnight at 4 °C and concentrated with 10 kDa MWCO Amicon centrifugal filters (Sigma). Protein concentrations were determined by Bradford assay ...
-
bioRxiv - Neuroscience 2023Quote: ... 10% glycerol) with 1 mM DTT supplemented with cOmplete EDTA-free Protease Inhibitor Tablet (Sigma, 11873580001). After centrifugation (Eppendorf 5810R Centrifuge ...
-
bioRxiv - Physiology 2023Quote: ... Triglycerides (TG) were quantified spectrophotometrically using Free Glycerol & Triglyceride agents (Sigma-Aldrich, St. Louis, MO, USA) as previously described73 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... we diluted spores from −80°C glycerol frozen stocks in KK2 buffer (2.25g KH2PO4 (Sigma-Aldrich) and 0.67g K2HPO4 (Fisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... resuspended in cell storage buffer (1x PBS [pH 7.2], 10% glycerol, 2x Sigma protease inhibitor table), and then stored in the -80ºC freezer ...
-
bioRxiv - Microbiology 2023Quote: ... All cultures were diluted in DPBS containing 10% glycerol and 2% PVP-40 (polyvinylpyrrolidine, Sigma Aldrich) (38 ...
-
bioRxiv - Microbiology 2023Quote: ... both cultures were diluted in DPBS containing 10% glycerol and 2% PVP-40 (polyvinylpyrrolidine, Sigma Aldrich) (38) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 30 μl of supernatant were mixed with 100 μl Free Glycerol Reagent (Cat. # F6428, Sigma-Aldrich) in a 96-well plate and incubated for 5 min at 37°C ...
-
bioRxiv - Physiology 2023Quote: ... and total triglycerides were measured enzymatically using a triglyceride and free glycerol determination kit (#TR0100, Sigma) following the manufacturer’s instructions.
-
bioRxiv - Physiology 2023Quote: ... The triglycerides were determined using Serum Triglyceride Determination Kit (Sigma TR0100; Glycerol Standard Solution Sigma G7793)59.
-
bioRxiv - Microbiology 2023Quote: ... 0.5% (v/v) glycerol and with Tyloxapol 0.05% (v/v; Sigma-Aldrich, Burlington, MA, United States) prior to inoculation in a minimal medium (MM ...
-
bioRxiv - Biochemistry 2023Quote: ... 50 mM NaCl and 5% glycerol pH 7.4) supplemented with freshly added 5 mM desthiobiotin (Sigma) to form “EB” ...
-
bioRxiv - Microbiology 2023Quote: ... After adding 2.5 mL of 50% glycerol (with a few crystals of palladium black (Sigma-Aldrich)) ...
-
bioRxiv - Microbiology 2023Quote: ... PAO1-GFP was grown from glycerol stock on LB (Lysogeny Broth) Miller with agar (Sigma-Aldrich) plates supplemented with 15 μg/mL gentamicin overnight at 37 °C ...
-
bioRxiv - Microbiology 2023Quote: ... 120mM Tris HCl pH=6.8 and 20% glycerol(v/v)) containing 5% 2-mercaptoethanol (Sigma-Aldrich). Samples were resolved on a 10% SDS-PAGE gel in 1 × Tris glycine SDS buffer ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... we diluted spores from −80°C glycerol frozen stocks in KK2 buffer (2.25g KH2PO4 (Sigma-Aldrich) and 0.67g K2HPO4 (Fisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... dialysis was performed for 12 h against the buffer A containing 50% glycerol (Sigma-Aldrich, USA). The His-tag of the recombinant protein was removed during 12 h of incubation with 1-2 units of the enteropeptidase (L-HEP ...
-
bioRxiv - Microbiology 2024Quote: Bacteria from lung homogenates were enumerated by plating on cetrimide + 1 % glycerol agar plates (Sigma-Aldrich) and incubated overnight in 37°C ...
-
bioRxiv - Biochemistry 2024Quote: ... before mounting with anti-fade solution (0.02% p-phenylenediamine [Sigma, P6001] in 90% glycerol in PBS). Cells were imaged on a Nikon Eclipse Ti2 confocal microscope ...