Labshake search
Citations for Millipore Sigma :
1001 - 1050 of 10000+ citations for 3 4 Fluorophenyl 5 fluorobenzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Strains with AID degrons were treated with 250 µM auxin (3-indole acetic acid; Sigma-Alrich) in DMSO 30 minutes before harvesting ...
-
Higher meiotic chromosome condensation: a potential function of kinetochore through polo-like kinasebioRxiv - Cell Biology 2024Quote: ... Cells were grown in YPD from 0.2 to 0.5 OD600 before auxin (3-Indoleacetic acid, Sigma) was added at 1.5 mM concentration and the culture was incubated for a further 2 hrs at 30⁰C ...
-
bioRxiv - Microbiology 2024Quote: ... 1/3 volume of acid-washed glass beads (diameter of 0.17–0.18 mm, Sigma, München, Germany) was added ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cells were fixed with Carnoy’s fixative (3:1 methanol [Sigma, 494437] to acetic acid [Sigma, A6283]) and washed three times ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cells were fixed with Carnoy’s fixative (3:1 methanol [Sigma, 494437] to acetic acid [Sigma, A6283]) and washed three times ...
-
bioRxiv - Cell Biology 2024Quote: ... a stock solution of 0.5 M indole-3-acetic acid sodium salt (auxin, IAA, Sigma # I5148) was prepared in water and stored in a frozen aliquot ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.05% Igracure 2959 and 4% of 10 mg/ml Acrylic-acid NHS/DMSO (A8060, Sigma) in milliQ water ...
-
bioRxiv - Microbiology 2020Quote: ... Nucleic acids were stained with 4′,6-diamidino-2-phenylindole (DAPI, Sigma, 1 µg/mL) and the cells were washed three times with PBS ...
-
bioRxiv - Biophysics 2020Quote: ... 71.7 mM acrylic acid N-hydroxysuccinimide ester (in DMSO, 4% by volume, Sigma Aldrich, A8060), and H2O (63.25% by volume ...
-
bioRxiv - Immunology 2022Quote: ... The matrix used was a saturated solution of α-cyano-4-hydroxycinnamic acid (Sigma- Aldrich) or sinapic acid (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2021Quote: ... were diluted to a final concentration of 10-4 M and bile acid (TDCA; Sigma) was diluted to 10-5 M in ACSF immediately before the experiment ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein concentration was estimated using 4% copper sulfate and bicinchoninic acid (Sigma, USA, Cat#B9643). Protein samples were separated by 8-12% SDS-PAGE ...
-
bioRxiv - Microbiology 2023Quote: ... growth plates were supplemented with 25 µM cumate (4-Isopropylbenzoic acid; Millipore Sigma SKU 268402) diluted from a 25 mM (1000X ...
-
bioRxiv - Cancer Biology 2024Quote: Agents used include All-Trans retinoic acid (RA) (CAS no. 302-79-4 Sigma-Aldrich) and Palbociclib (Cat no ...
-
bioRxiv - Cell Biology 2023Quote: ... strains containing a degron tag were arrested at 30 °C for 3 hours (total) and then treated with 250 μM 3-indole acetic acid (Sigma-Alrich, St. Louis, MO) for 30 minutes before harvesting ...
-
bioRxiv - Bioengineering 2022Quote: Films (N = 5 per condition) were lyophilized and incubated for 48 h in 5 wt% trichloroacetic acid (TCA, T6399, Sigma-Aldrich). Scaffolds (N = 5 per condition ...
-
bioRxiv - Microbiology 2021Quote: ... with 1.5% agar supplemented with 2 mg/mL 5-Fluoroorotic acid (US Biological, USA) and 5 µg/mL uracil (Sigma-Aldrich USA). Confirmation of plasmid excision was made by negative selection in BHIS-15% thiamphenicol plates ...
-
bioRxiv - Microbiology 2022Quote: ... AT depots were cut into ≈ 20 mg explants and incubated for 2 hours at 37°C in 96-well plates containing 200 μL low glucose DMEM with 5% (w/v) fatty acid-free BSA and 5 μM of Triacsin C (Sigma, T4540) per well ...
-
bioRxiv - Molecular Biology 2023Quote: ... Slides were then washed 5-6x for 5 min with water and then rinsed in 1% Phosphomolybdic acid (Sigma-Aldrich, HT153) for 10 min and rinsed in water for 5 min ...
-
bioRxiv - Biochemistry 2022Quote: ... Pellets were resuspended in lysis buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 5 mM MgSO4, 5 mM 6-aminocaproic acid (Sigma, cat. #A2504), 5 mM benzamidine (Sigma ...
-
bioRxiv - Biophysics 2020Quote: ... The cells were collected by centrifugation (6000 g, 5 min, 4 °C, Sigma 4-16KS tabletop centrifuge), lysed in lysis buffer (5 mM Tris ...
-
bioRxiv - Molecular Biology 2024Quote: ... HTH-02-006 (provided by OICR) and 4-hydroxytamoxifen (4-OHT; Sigma-Aldrich, #H6278; 5 μg/mL). These components were added to culture conditions for various amounts of time based on experimental design ...
-
bioRxiv - Microbiology 2021Quote: 5-aza-2’-deoxycytidine (5-AzadC, A3656) and epigallocatechin-3-gallate (EGCG, E4143) were purchased from Sigma Aldrich. Antibodies against CREB (sc-186) ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 mM DTT) and eluted with Buffer A supplemented with 5 mM DTT and 3 mM Desthiobiotin (SIGMA). Peak fractions were combined and further purified via size exclusion chromatography on a Superdex 200 (GE Healthcare Life Sciences ...
-
bioRxiv - Cell Biology 2020Quote: ... 3-Isobutyl-1-methylxanthine (15879) and 8-Bromoadenosine 3’,5’-cyclic monophosphate sodium salt (B7880) were purchased from Sigma. Phosphodiesterase inhibitor Tocriset containing Milrinone ...
-
bioRxiv - Microbiology 2022Quote: ... HFFs were infected with 5 ×⍰104 parasites per well and treated with 3 µM 3-MB-PP1 (MilliPore Sigma) or equivalent dilution of DMSO for 20 min prior to analysis.
-
bioRxiv - Cell Biology 2023Quote: ... except the protein sample was concentrated to 4 mg/ml and mixed with 0.005% 3-([3-Cholamidopropyl]dimethylammonio)-2-shydroxy-1-propanesulfonate (CHAPSO; Sigma Aldrich) immediately before vitrification ...
-
bioRxiv - Pathology 2023Quote: ... The solvent (n=5) or an FXIa inhibitor (ONO-1600586, 3 µmol/L n=5) and mepacrine (Sigma-Aldrich; final concentration 5 µM) were added to the blood before perfusion ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Pol κ (Polκ3’) (5’ACUCCAGCCUGAAGAGCGA3’ from Sigma-Aldrich), USP7 (5’CCCAAAUUAUUCCGCGGCAAA3’ from Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2020Quote: ... washed 3 × 5 min in PBS with 0.1% Tween (both Sigma Aldrich) and probed for 1 h at room temperature in the dark with IRDye® conjugated secondary Abs against goat IgG (800CW ...
-
bioRxiv - Immunology 2021Quote: ... Scrambled non-targeting siRNA (5’-AAUUCUCCGAACGUGUCACGU-3’) was used as control (Sigma). Briefly ...
-
bioRxiv - Developmental Biology 2024Quote: ... 0.1 mM 8-Bromoadenosine 3’,5’-cyclic monophosphate sodium salt (Sigma, No.B7880) and 0.1 mM 3-Isobutyl-1-methylxanthine (IBMX ...
-
bioRxiv - Molecular Biology 2024Quote: Sym/Sub RNA with sequence 5 [GCAUGGGCCC 3 [was synthesised (Sigma Aldrich) and 5′ end labelled using γ32P UTP (Perking Elmer ...
-
bioRxiv - Genetics 2024Quote: ... then 5 IU of hCG (Millipore Sigma, Cat# 9002-61-3 C1063) 48 hr later ...
-
bioRxiv - Cell Biology 2024Quote: ... and siTGN46 with 5’-CCACCGAAAGCGUCAAGCAAGAAGA-3’ sequence were obtained from Sigma-Aldrich. Huh7-ACE2 cells were transfected with siRNA oligos (final concentration ...
-
bioRxiv - Cell Biology 2023Quote: ... The coverslips were treated for 5 min with APES (3-Aminopropyltriethoxysilane, Sigma) and thoroughly rinsed ...
-
bioRxiv - Cell Biology 2023Quote: ... blocked with 3% BSA in PBS and 5% Goat Serum (Sigma, #G9023) for 1h before being incubated with primary antibodies in 3% BSA in PBS for 1h ...
-
bioRxiv - Molecular Biology 2023Quote: ... siRNA sequences (5’ – 3’) are the following: Universal siRNA control (Sigma, SIC001)
-
bioRxiv - Cell Biology 2023Quote: ... 0.1 mM 8-bromoadenosine 3′,5′ cyclic monophosphate sodium salt (Sigma-Aldrich), and 0.1 mM 3- isobutyl-1-methylxanthine (IBMX ...
-
bioRxiv - Developmental Biology 2023Quote: ... including Bromoadenosine 3’,5’-cyclic monophosphate sodium salt (8Br-cAMP, Sigma B7880), N6,2’-O-Dibutyryladenosine 3’,5’-cyclic monophosphate sodium salt (DB-cAMP ...
-
bioRxiv - Bioengineering 2024Quote: ... eGFP reverse: 5′-AAG TCG TGC TGC TTC ATG TG -3′ (Sigma); GAPDH forward ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and 0.5 mM 8-bromo-adenosine-3’,5’-cyclic monophosphate (Sigma-Aldrich) in Phenol-red free DMEM/F-12 medium (Gibco ...
-
bioRxiv - Cell Biology 2024Quote: ... soft PDMS was incubated with 5% (3-Aminopropyl)triethoxysilane (Sigma-Aldrich, #281778) diluted in absolute ethanol for 3 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... N6,2-O-Dibutyryladenosine 3’,5’-cyclic monophosphate sodium salt (D0627, Sigma-Aldrich), and ascorbic acid ...
-
bioRxiv - Cancer Biology 2021Quote: ... Membranes were blocked overnight at 4°C in 5% BSA (Sigma) then probed using pERK and tERK antibodies (Cell signalling ...
-
bioRxiv - Molecular Biology 2022Quote: ... or 4-amino-5-phosphonooxymethyl-2-methylpyrimidine (HMP)(Sigma-Aldrich, USA), at the indicated concentrations for each of the experiments ...
-
bioRxiv - Microbiology 2020Quote: ... Human mAbs were concentrated using Amicon Ultra-4 5 kDa (Millipore). Antibody concentration was determined by absorbance measurement at 280 nm using a Nanodrop and purity was determined using SDS-PAGE ...
-
bioRxiv - Systems Biology 2020Quote: 5’-(4-Fluorosulfonylbenzoyl) adenosine hydrochloride (FSBA) was obtained from Sigma-Aldrich. 1×107 DG75 cells were pelleted and lysed in NP40 buffer containing cOmplete ...
-
bioRxiv - Biochemistry 2020Quote: ... SUPELCOSIL LC18 (30 cm x 4 mm, 5 μm, Sigma-Aldrich), or an Eclipse XDB-C18 column (150 mm x 4.6 mm ...
-
bioRxiv - Molecular Biology 2021Quote: ... pombe cells were labeled with 5 mM 4-Thiouracil (Sigma-Aldrich) for 5 min ...