Labshake search
Citations for Millipore Sigma :
951 - 1000 of 10000+ citations for 3 4 Fluorophenyl 5 fluorobenzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... and 5 μL of thrombin (4 units/ml, Sigma, UK) were mixed ...
-
bioRxiv - Neuroscience 2024Quote: ... 5′-cyclic monophosphate (dibutyryl cAMP) (Sigma-Aldrich, 60-92-4) and 2 ng/mL GDNF (Pepro Tech ...
-
bioRxiv - Molecular Biology 2021Quote: A CU RNA hairpin (5’-AAAAGAAAAGACGCGUAGUUUUCUACGCG- 3’) labeled with Cyanine 5.5 at the 5’-end (Millipore Sigma) was annealed in 20 mM HEPES ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Polη (5’GCAAUGAGGGCCUUGAACA3’ from sigma-Aldrich) and Rev1 (5’CAGCGCAUCUGUGCCAAAGAA3’ from Sigma-Aldrich). For control ...
-
bioRxiv - Plant Biology 2023Quote: ... SD-WLH plates were supplemented with either 2.5 or 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich).
-
bioRxiv - Cancer Biology 2024Quote: ... 5’ – CACCGCCGCCTCCGCGCTTCCCCGA – 3’ PIEZO1_sgRNAact_TSS143 (guide 3): 5’ – CACCGAGGCCCCAACGCACCAGGGC – 3’ Modified U251 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; D5796, Sigma), supplemented with 10% foetal bovine serum (FBS ...
-
bioRxiv - Biochemistry 2020Quote: ... and 5-tetradecyloxy-2-furoic acid (TOFA; combination SCD-1Δ9 /ACC1 inhibitor, Sigma-Aldrich).
-
bioRxiv - Microbiology 2021Quote: ... The resulting peptides were extracted in 70% ethanol plus 5% formic acid (Merck-Millipore) twice for 20 min with permanent shaking ...
-
bioRxiv - Cancer Biology 2020Quote: ... acid ascorbic (5 mg/ml) and basic fibroblast growth factor (1 ng/ml; Sigma) as described by Weksler et al ...
-
bioRxiv - Microbiology 2022Quote: ... 5-dithio-bis (2-nitrobenzoic acid) or DTNB (Sigma-Aldrich, St Louis, MO, USA), 0.1 M sodium phosphate buffer (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2022Quote: ... Ponceau S (PonS) (0.2% w/v in 5% glacial acetic acid, Sigma-Aldrich, #P3504) served as a loading control (Sturmlechner et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... 10% and 5% ethylene diamine tetraacetic acid (EDTA, Sigma-Aldrich, St. Louis, MO, USA) as previously reported (Lan et al. ...
-
bioRxiv - Microbiology 2020Quote: ... Plates were developed in the first dimension with 5 parts isobutyric acid (Sigma #I1754) to 3 parts 0.5 M ammonia (VWR #BDH153312K ...
-
bioRxiv - Genomics 2021Quote: ... A single colony was transferred to 5 mL YNB without amino acids (Sigma Y1250) prepared according to the manufacturer’s instructions plus 2% glucose ...
-
bioRxiv - Cell Biology 2022Quote: ... both pH 7 and pH 5 (acidified CzM with 2-morpholinoethanesulfonic acid, Sigma, USA). Samples were grown on 9 cm Petri dishes ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 50 mg/μL of ascorbic acid (Sigma, A4544, 5 ng/ml VEGF (Preprotech) and 10 ng/mL IL6 (Preprotech) ...
-
bioRxiv - Plant Biology 2023Quote: ... Dry samples (∼5 mg) were digested with nitric acid 65% (EMD Millipore Cat. 1.00456.2500) and hydrogen peroxide 30 % (Sigma-Aldrich Cat ...
-
bioRxiv - Developmental Biology 2023Quote: ... 10 μL of myristic acid-d27 (100 μg/mL; 60658-41-5, Sigma-Aldrich) and 10 μL 4-phenylbutyric acid (100 μg/mL ...
-
bioRxiv - Pathology 2023Quote: ... one dose of aristolochic acid I (AAI, A9451, Sigma; 5 mg/kg body weight) or normal saline (NS ...
-
bioRxiv - Cell Biology 2024Quote: ... The reaction was stopped using 5 µl of 0.5 M Ethylenediaminetetraacetic Acid (EDTA, Sigma). Fragments of about 350 bp were purified and single-indexed DNA libraries were prepared using standard Illumina TruSeq Nano DNA Library Prep (Reference Guide 15041110 D ...
-
bioRxiv - Cancer Biology 2024Quote: ... formic acid (98+%) by Thermoscientific (147930010) and deionised water by Millipore (7732-18-5). Stock solutions of 1 mg/mL doxorubicin and colchicine were prepared by dissolving 10 mg of each in 10 mL Water ...
-
bioRxiv - Microbiology 2021Quote: ... Cell pellets were lysed in 3 ml BugBuster HT (Millipore, #70922-4) for 30 min at room temperature on a rotator ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 mM 3-isobutyl-1-methylxanthine (IBMX) (Sigma, Germany #28822-58-4). After 48 h the induction medium was replaced by the differentiation medium containing DMEM/Ham’s F12 ...
-
bioRxiv - Pathology 2021Quote: ... N″-triacetylchitotrioside [4-MU-β-(GlucNAc)3] (Sigma, St. Louis, MO, USA) as the substrate ...
-
bioRxiv - Neuroscience 2023Quote: ... D-Cyc (D-4-amino-3-isoxazolidone, 20 μg/μl; Sigma-Aldrich), AP5 (2-amino-5-phosphonopentanoate ...
-
bioRxiv - Neuroscience 2023Quote: ... testosterone-filled (4-androsten-17β-ol-3-one, Sigma Aldrich T-1500) Silastic tubes (2.16 OD x 1.02 ID ...
-
bioRxiv - Bioengineering 2023Quote: ... and 4-(Methylnitrosoamino)-1-(3-pyridinyl)-1-butanone (NNK) (78013, Millipore-Sigma) (0.41 mg/dose ...
-
bioRxiv - Bioengineering 2023Quote: ... and 4-(Methylnitrosoamino)-1-(3-pyridinyl)-1-butanone (NNK) (78013, Millipore-Sigma) (0.41 mg/dose ...
-
bioRxiv - Bioengineering 2024Quote: ... (4) the same supplemented with 3 μM free chloroquine diphosphate (Millipore Sigma), (5 ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... obtained by diluting testosterone (4- androsten-17b-ol-3-one; Sigma #86500) in commercial sesame to a concentration of 4 µg/µL ...
-
bioRxiv - Immunology 2024Quote: ... followed by 4 - 5 hours of stimulation by phorbol myristate acetate (PMA, 5 ng/ml, Sigma) and ionomycin (500 ng/ml ...
-
bioRxiv - Immunology 2023Quote: ... 4 weeks after BM transplantation animals were injected with 5-FU (5-fluorouracil F6627, Sigma-Aldrich) at a dose of 150 mg/kg in 100ul of PBS ...
-
bioRxiv - Genetics 2021Quote: ... late L4 animals were mock treated or exposed to 1 mM auxin (3-indoleacetic acid, Sigma) for 24 h ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.05 % bromophenol blue) and mechanically homogenized using acid-washed glass beads for 3 min (Sigma-Aldrich) then incubated at 95°C for 5 min ...
-
bioRxiv - Cell Biology 2021Quote: ... and NaN3 to a final concentration of 0.1 M phosphate and 0.5 mM TMSP ((3-trimethylsilyl)propionic-(2,2,3,3-d4)-acid sodium salt) and 1.5 mM NaN3 (all from Sigma) and transferred to 3 mm NMR tubes (Cortecnet).
-
bioRxiv - Genetics 2022Quote: Indole-3-acetic acid powder (125 mg) was dissolved in 1 mL PBS (Sigma-Aldrich, D8537), with small quantities of NaOH (IGC Technical Services ...
-
bioRxiv - Molecular Biology 2022Quote: ... induction of AID-tagged protein depletion was performed with 3-indole-acetic acid (IAA) (Sigma-Aldrich) during the exponential growth phase (approx ...
-
bioRxiv - Neuroscience 2021Quote: ... The brain sections were then homogenized in a 3:1 PBS: trichloroacetic acid (TCA) (Sigma-Aldrich) solution to precipitate out macromolecular compounds ...
-
bioRxiv - Molecular Biology 2021Quote: ... for 1h and subsequently developed using 2,2-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) substrate (Sigma). Absorbance was measured at 405nm in a BioTek Synergy HTX multi-mode reader ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were incubated for 3 hrs in glucose-free DMEM/fatty acid-free BSA (Sigma-Aldrich) 0.2% ...
-
bioRxiv - Cell Biology 2022Quote: ... a stock solution of 0.5 M Indole-3-acetic acid sodium salt (auxin, IAA, Sigma # I5148) was prepared in water and stored in a frozen aliquot ...
-
bioRxiv - Microbiology 2021Quote: ... A carboxylated indene standard (1H-Indene-3-carboxylic acid) was purchased from Sigma-Aldrich (catalog #MNO000013). Hexanes and acetone (Fisher) ...
-
bioRxiv - Cell Biology 2022Quote: ... Strains with AID degrons were treated with 250 µM auxin (3-indole acetic acid; Sigma-Alrich) in DMSO 30 minutes before harvesting ...
-
Constitutive and conditional epitope-tagging of endogenous G protein coupled receptors in DrosophilabioRxiv - Neuroscience 2023Quote: ... Brains were fixed in 3% glyoxal with acetic acid (Sigma-Aldrich, Cat#128465, St. Louis, MO) for 25 minutes at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... Colonies were fixed in methanol-acetic acid 3:1 and stained with 5mg/ml GIEMSA (Sigma). Cell survival was expressed relative to control cells ...
-
bioRxiv - Immunology 2023Quote: ... 100 μl/well of 2,2’-Azinobis [3-ethylbenzothiazoline-6-sulfonic acid]-diammonium salt (ABTS, Sigma, A1888) was added to the plates and the reaction was stopped by the addition of 5% SDS ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... samples were enriched with 25nM 1-cyclohexyl-3-uriedo-decanoic acid (Sigma-Adlrich, St. Lousi MO) as an internal standard ...
-
bioRxiv - Molecular Biology 2023Quote: ... and JUN degradation was induced by adding 100 µM Indole-3-acetic acid (IAA, Sigma-Aldrich).
-
bioRxiv - Neuroscience 2023Quote: ... a droplet of Pt-black electroplating solution containing 3 wt% chloroplatinic acid hexahydrate (206083, Sigma-Aldrich) and 0.3 wt% lead(II ...
-
bioRxiv - Cancer Biology 2023Quote: ... embryos were anaesthetized with 0.02% buffered 3-aminobenzoic acid ethyl ester (tricaine; Sigma-Aldrich, A-5040) in egg water.