Labshake search
Citations for Millipore Sigma :
801 - 850 of 10000+ citations for 3 4 Fluorophenyl 5 fluorobenzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... were added to Ames’ media to the following concentrations: 3 mM kynurenic acid (Sigma), 50 µM DL-AP4 (Tocris) ...
-
bioRxiv - Genomics 2024Quote: ... and 3 mg/mL Poly(vinylsulfonic acid, sodium salt) solution (PVSA, Sigma Aldrich, 278424) (1x PBSTw) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 mg/ml alpha-cyano-4-hydroxycinnamic acid (CHCA, Sigma-Aldrich, Munich, Germany) matrix was prepared in 50% (v/v ...
-
bioRxiv - Bioengineering 2021Quote: ... 242.6 mg of 4-(2-hydroxyethyl)piperazine-1-ethanesulfonic acid (HEPES, Sigma-Aldrich) was dissolved in 1 L of deionized water with a pH value that was adjusted to 8.0 to make 1 mM HEPES buffer solution ...
-
bioRxiv - Bioengineering 2020Quote: ... A thin sacrificial layer of poly(4-styrenesulfonic acid) solution (561223, Sigma-Aldrich) was spin-coated on 4” Si wafers (1000 rpm ...
-
bioRxiv - Bioengineering 2020Quote: ... A thin sacrificial layer of poly(4-styrenesulfonic acid) solution (561223, Sigma-Aldrich) was spin-coated on the wafers (1500 rpm ...
-
bioRxiv - Microbiology 2020Quote: ... 10 mg/mL a-cyano-4-hydroxycinnamic acid (HCCA, Sigma, St. Louis, MO) in 50% acetonitrile ...
-
bioRxiv - Bioengineering 2020Quote: ... A thin sacrificial layer of poly(4-styrenesulfonic acid) solution (561223, Sigma-Aldrich) was spin-coated on the wafers (1500 rpm ...
-
bioRxiv - Microbiology 2022Quote: ... Cell pellets were treated with 0.2% tannic acid (Sigma-Aldrich: 1401-55-4) in 50 mM cacodylate (pH 7.2 ...
-
bioRxiv - Microbiology 2022Quote: ... Standard curves were generated using 4-aminobenzoic acid (Sigma-Aldrich, catalog no. A9878) and 2-aminoimidazole (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... and nucleic acids were stained with 4’,6-diamidino-2-phenylindole (DAPI, Sigma). Stained parasites on the coverslips were mounted using Immu-mount (Fisher 9990402) ...
-
bioRxiv - Biophysics 2023Quote: ... followed by blocking with 4% fatty acid-free Bovine Serum Albumin (BSA, Sigma) solution in PBS ...
-
bioRxiv - Biophysics 2024Quote: ... Arachidonic Acid Methyl Ester (AAMe) (Sigma-Aldrich, A9298, CAS number: 2566-89-4), Eicosapentaenoic acid (EPA ...
-
bioRxiv - Microbiology 2024Quote: ... Cell pellets were treated with 0.2% tannic acid (1401-55-4; Sigma-Aldrich) in 50 mM cacodylate (pH 7.2 ...
-
bioRxiv - Microbiology 2024Quote: ... Proteins in the supernatant were precipitated with 1:4 trichloroacetic acid (Sigma Aldrich). The pellet was washed and disrupted with acetone two times and re-dissolved in 200 mM ammonium bicarbonate with 6 M Urea (Sigma Aldrich) ...
-
bioRxiv - Cell Biology 2024Quote: ... nanoparticles were mixed with the diazonium derivative 4-aminophenylacetic acid (Sigma Aldrich, USA) and were processed for 30 minutes using a submersible ultrasonic activator ...
-
bioRxiv - Cell Biology 2024Quote: ... and 4 µM phytic acid dipotassium salt (Sigma, 5681, CAS: 129832-03-7) for the indicated time.
-
bioRxiv - Microbiology 2024Quote: ... 4-Isopropylaniline and L-Glutamic acid were purchased from Sigma-Aldrich (Steinheim, Germany). L(+)-Arabinose ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 mM CuSO4*5H2O and 10 mM freshly prepared L-Ascorbic Acid (Sigma). Cells were washed in 0.1% Triton X-100 in PBS for 15 minutes and thereafter incubated with 4,6-Diamidino-2-phenylindole (DAPI ...
-
bioRxiv - Immunology 2024Quote: ... and 25 mM (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES; Sigma-Aldrich; H0887) in a humidified 5% carbon dioxide atmosphere at 37 °C 15 ...
-
bioRxiv - Cell Biology 2024Quote: ... and 4 μM phytic acid dipotassium salt (Sigma, 5681, CAS: 129832-03-7) for the indicated time points.
-
bioRxiv - Biochemistry 2024Quote: ... and HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) were purchased from Millipore Sigma. Texas Red-DHPE (1,2-Dihexadecanoyl-sn-Glycero-3-Phosphoethanolamine ...
-
bioRxiv - Bioengineering 2023Quote: ... gels were washed 3 times x 5 minutes with a 3% Bovine Serum Albumin (BSA, Sigma) blocking solution in PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... Bottom coverslips are activated with a 2% 3-Aminopropyltrimethoxysilane (3-APTMS) (Sigma Aldrich 13822-56-5) in 96% ethanol solution for 5 minutes and washed with 70% ethanol ...
-
bioRxiv - Molecular Biology 2024Quote: ... or SC-Leu-Trp-His +5 mM 3-AT (3-Amino-1,2,4-triazole, Sigma, 18056-25G). Plates were incubated at 30°C and imaged daily for at least three days.
-
bioRxiv - Immunology 2023Quote: ... 5 ml of PBS and 5 ml of 4% Dextran (Sigma-Aldrich, 31392-50G) in PBS (Gibco ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: The 5-HT2C antagonist 6-Chloro-2,3-dihydro-5-methyl-N-[6-[(2-methyl-3-pyridinyl)oxy]-3-pyridinyl]-1H-indole-1-carboxamide dihydrochloride (SB242084; Sigma Aldrich) at a dose of 1.0 mg/kg.
-
bioRxiv - Developmental Biology 2024Quote: ... Tg(actab2:loxP-BFP-STOP-loxP-dsRed)sd27 fish were treated overnight at 5 dpf with 5 μM (Z)−4-Hydroxytamoxifen (4-OHT) (Sigma-Aldrich H7904) in EM ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... purity ≥ 95%, fraction V fatty acid free) and hexadecanoic acid (CAS 57-10-3, natural, purity ≥ 98%) were from Millipore Sigma (Burlington, MA). HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) ...
-
bioRxiv - Microbiology 2022Quote: ... a 50:50 mixture of ALI x2 media (Airway Epithelial Cell Basal Medium with 2 supplement packs added (without triiodo-L-thyronine and retinoic acid supplements) and 1 ml BSA (3 µg/ml)) and DMEM supplemented with retinoic acid (15 ng/ml) (Sigma Aldrich, Gillingham, UK). Cells were fed apically and basolaterally until 100% confluent ...
-
bioRxiv - Bioengineering 2023Quote: ... Confluent monolayers were treated with 8-(4-chlorophenylthio)adenosine 3′,5′-cyclic monophosphate sodium salt (cPT-cAMP; Sigma-Aldrich, cat# C3912, 25-250 µM) Ro 20-1724 (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2024Quote: ... Phosphatase activity was determined by a chromogenic reaction using 5-bromo-4 chloro-3 indolyl phosphate and nitroblue tetrazolium (Sigma, St. Louis, MO, USA) as substrates.
-
bioRxiv - Immunology 2024Quote: ... The reaction was visualized by subsequent addition of BCIP/5-bromo-4-chloro-3-indolylphosphate/nitro blue tetrazolium substrate (Sigma-Aldrich Cat#B5655-5TAB). The number of spots was determined using a CTL ImmunoSpot S5 UV Analyzer equipped with ImmunoSpot ImmunoCapture and ImmunoSpot Counting software (Cellular Technology Ltd. ...
-
bioRxiv - Immunology 2024Quote: ... cells (1-2.5×105 cells/well) were stimulated with a pool of 18-amino acid peptides overlapping by 15 amino acids (Sigma Aldrich) spanning the Chlamydia muridarum CPAF S491A antigen (final concentration of 2.5μg/ml)27 on PVDF-membrane plates (Millipore ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 × 5 minutes each and were mounted using Fluorosave (Millipore) before imaging ...
-
bioRxiv - Immunology 2021Quote: ... siRNA-TDP-43 D: 5’-GAAACAAUCAAGGUAGUAA[dT][dT]-3’ (Sigma)4 ...
-
bioRxiv - Microbiology 2021Quote: ... 5 × 10−3 g/L human insulin (Sigma Aldrich, USA), 5 × 10−5 M hydrocortisone (Upjohn Laboratories SERB ...
-
bioRxiv - Microbiology 2020Quote: ... Reverse Primer 5’-TGGTTGAGCACAGGGTACTT-3’] were synthesized by Sigma-Aldrich, USA ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM MgCl2 and phosphatase (phosphatase inhibitor cocktail 3, Sigma) and protease inhibitors (EDTA free cOmplete™ protease inhibitors ...
-
bioRxiv - Cell Biology 2021Quote: ... (3) TGFβ2 (5 ng/ml) + GsMTx4 (500 nM; Sigma-Aldrich), or (4 ...
-
bioRxiv - Physiology 2022Quote: ... 3 nM 3,3’,5-Triiodo-L-thyronine sodium salt (Sigma), 10 ng/ml EGF (Sigma) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The membranes were blocked in 3-5% skimmed milk (Sigma) dissolved in Tris buffered saline + 0.2% v/v Tween-20 (TBST) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 2’-O-dibutyryladenosine 3:5-cyclic monophosphate (dbcAMP; Sigma-Aldrich), and 0.1 mM 3-isobutyl-1-methyl xanthine (IBMX ...
-
bioRxiv - Immunology 2024Quote: ... reverse primer (5’-3’): GACGGTGCCATGGAATTTGC) and purchased from Sigma-Aldrich. RT-qPCR was performed with gene-targeted primers using TB Green Premix Ex Taq II (Tli RNase H Plus ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were exposed to 3-Methyladenine (5 mM; Sigma, M9281) for 24 hours ...
-
bioRxiv - Cell Biology 2021Quote: ... Aprotinin (1:5, 4 TIU/ml; Sigma-Aldrich, UK) was added to all blood samples ...
-
bioRxiv - Immunology 2020Quote: ... for 4 hrs and 5 mM ATP (Sigma, A26209) for different periods up to 4 hours.
-
bioRxiv - Genomics 2022Quote: ... 4 mL of 5 mM IBMX (Sigma, #I-5879), 1 ng/mL Heparin (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... rabbit anti-aquaporin 4 (Sigma Millipore, 5 μg/ml), rabbit anti-aquaporin 5 (Sigma Millipore ...
-
bioRxiv - Immunology 2023Quote: ... rabbit anti-aquaporin 4 (Sigma Millipore, 5 μg/ml), rabbit anti-aquaporin 5 (Sigma Millipore ...