Labshake search
Citations for Millipore Sigma :
1101 - 1150 of 10000+ citations for 3 4 Fluorophenyl 5 fluorobenzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... PIP (phosphatidylinositol phosphate) strip membranes were blocked in 3% (w/v) fatty acid-free BSA (Sigma-Aldrich) in TBST (50 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2023Quote: ... cultures were split with one half being treated with 250 µM 3-indoleacetic acid (IAA; Millipore Sigma) and the other half with an equal volume of DMSO ...
-
bioRxiv - Biochemistry 2024Quote: ... DNP-Dpa is N-3-(2,4-dinitrophenyl)-L-2,3 diaminopropionic acid]) (Sigma Aldrich Cat. no. SCP0193-1MG) at a final concentration of 7.5 µM was added to the preincubated N-TIMP2:MMP solution ...
-
bioRxiv - Cell Biology 2024Quote: ... either 100 µM of Indole-3-acetic acid sodium salt (Sigma #I5148, 250 mM stock in DMSO) or 5 µM of 5-Ph-IAA (Medchemexpress #HY-134653 ...
-
bioRxiv - Neuroscience 2024Quote: ... larvae were anesthetized with 200 mg/l 3-aminobenzoic acid ethyl ester (MS-222) (Sigma-Aldrich, A5040) and embedded laterally in 1.2% low-melting-point (LMP ...
-
bioRxiv - Neuroscience 2024Quote: Cell pellets from day 65 neuronal cultures were digested in 1 ml of 3 % Nitric acid (Millipore) on a shaker at 85°C overnight followed by an incubation of 2 h at 95°C the following day ...
-
bioRxiv - Microbiology 2024Quote: ... Pellets were resuspended in 0.8 mL 3:1:0.004 acetonitrile:methanol:formic acid + 10 nM verapamil (V105, Millipore Sigma) or 10 nM clarithromycin (A3487 ...
-
bioRxiv - Microbiology 2024Quote: ... D- (+)-3-Phenyllactic acid (D-PLA; 376906-5G) were obtained from Sigma-Aldrich (St. Louis, MO, USA). Lactate and D-PLA were resuspended in sterile water and ILA was mixed with 0.052% v/v DMSO ...
-
bioRxiv - Cancer Biology 2024Quote: ... additional tumor-bearing mice were treated q12 with 200 mg/kg IAA (3-indole acetic acid, Sigma) formulated in 10% DMSO ...
-
bioRxiv - Developmental Biology 2020Quote: ... oocytes were fixed for 10 min at 4°C with pre-cooled 10% trichloroacetic acid (Sigma). Next ...
-
bioRxiv - Microbiology 2020Quote: ... 1 µL of matrix solution composed of saturated α-cyano-4-hydroxycinnamic acid (Sigma, Lyon, France), 50% (v/v ...
-
bioRxiv - Microbiology 2021Quote: ... 150 μL of Kovacs reagent (4-dimethylaminobenzaldehyde and hydrochloric acid solution in n-butanol; Sigma Aldrich) was placed into a 96 well clear bottom plate for each sample to be measured ...
-
bioRxiv - Biochemistry 2022Quote: ... and 70 mg/L 2-Ketobutryic acid-4-13C,3,3,d2 sodium salt hydrate (Sigma 589276) as the precursors ...
-
bioRxiv - Developmental Biology 2022Quote: ... Standard samples were prepared by diluting the stock in 4% fatty acid free BSA (Sigma-Aldrich) in TBS to obtain 1 mM and stored at −80°C ...
-
bioRxiv - Microbiology 2022Quote: The substrate 2′-(4-Methylumbelliferyl)-α-D-N-acetylneuraminic acid sodium salt hydrate (MUNANA, Sigma-Aldrich) was dissolve in NA buffer (33 mM MES ...
-
bioRxiv - Cell Biology 2021Quote: ... paraformaldehyde (PFA) and 4-(2-hydroxyethyl)-1-piperazine-ethane-sulfonic acid (HEPES) were purchased from Sigma Chemical (St ...
-
bioRxiv - Cell Biology 2022Quote: ... beads were resuspended with 20 µL of 4-Morpholineethanesulfonic acid buffer (Sigma, M3885, MES, 50 mM) and incubated on mixer at room temperature for 15 minutes ...
-
bioRxiv - Bioengineering 2023Quote: ... 1 µL of matrix solution composed of saturated α-cyano-4-hydroxycinnamic acid (Sigma, Lyon, France), 50% (v/v ...
-
bioRxiv - Bioengineering 2023Quote: ... The PEG pre-polymer phase comprised 27.5% w/v 5 kDa 4-arm PEG acrylate (Advanced BioChemicals) with 4% w/v lithium phenyl-2,4,6-trimethylbenzoylphosphinate (LAP, Sigma) in phosphate buffered saline (PBS ...
-
bioRxiv - Bioengineering 2023Quote: ... d(AA)-3’ and antisense strand: 5’-r(UUU GCC AUG GCA GAA AUA GGC) d(TT)-3’ were purchased from Sigma–Aldrich ...
-
bioRxiv - Neuroscience 2024Quote: ... The AAV titer was quantified usizg PCR (5′-TGA GTC ACC CAC ACA AAG GA-3′ and 5′-CCA AGC TGG CCT AAC TTC AG-3′) after proteinase K treatment (Merck Millipore). Under anesthesia with a mixture of medetomidine (0.3 mg/kg ...
-
bioRxiv - Molecular Biology 2021Quote: An RNA oligonucleotide (5’ -UUUUCAUGCUACGCGUAGUUUUCUACGCG- 3’) with Cyanine 5.5 at the 5’-end was obtained from Millipore Sigma (USA). Prior to the reaction ...
-
bioRxiv - Neuroscience 2020Quote: ... the eluate was washed 3 times with PBS in an Amicon Ultra-4 Centrifugal Filter Unit (NMWL 3 kDa, Millipore, UFC800324) and finally concentrated to < 250 µl ...
-
bioRxiv - Neuroscience 2024Quote: ... Immunolabelling was performed overnight at 4°C with primary antibodies (Table 3) in blocking solution containing 3% normal goat serum (Sigma-Aldrich) and 0.3% Triton X-100 (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2020Quote: ... Aminocaproic acid (6-aminohexanoic acid, Sigma) at a final concentration of 2 mg/mL was added to both media ...
-
bioRxiv - Cell Biology 2020Quote: ... Whole blood was immediately mixed with 5 µl of aprotinin (1:5, 4 TIU/ml, Sigma-Aldrich UK) and kept on ice until it was centrifuged at 2600 g at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... After alkylation, 5 µg of mass spectrometry (MS) grade trypsin (Fisher, PI90057) dissolved in 5 µL 50 mM acetic acid (Sigma, 45754-100ML-F) was added to proteins on beads ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: For multiphoton microscopy kidneys were fixed in 4% paraformaldehyde overnight at 4 °C and embedded in 3% low-melting point agarose (Sigma- Aldrich). Sections (500 µM ...
-
bioRxiv - Immunology 2022Quote: ... 10 µl of hemolymph was mixed with 90 µl of 3, 4-Dihydroxy-L-phenylalanine (L-DOPA, 4 mg/ml)(Sigma Aldrich) dissolved in nuclease free water (Cytiva) ...
-
bioRxiv - Cancer Biology 2023Quote: ... cleared biopsies were blocked for 3–4 h at room temperature (RT) or overnight at 4°C in blocking buffer (PBS (Sigma-Aldrich), 10% Fetal Bovine Serum (FBS ...
-
bioRxiv - Plant Biology 2023Quote: ... Supernatants were incubated for 3-4 h at 4 °C with 15-20 μL of ANTI-FLAG® M2 Affinity Gel (Sigma) and washed 3-4 times with Co-IP wash buffer containing 0.1% Triton-100 but without Phosphatase Inhibitor Cocktails and Protease Inhibitor Cocktail ...
-
bioRxiv - Immunology 2024Quote: ... The filtered supernatant was then concentrated using a centrifugal filter unit with a 3 kDA cutoff at 4°C (Amicon Ultra-4 Centrifugal filters, Millipore, USA). Concentrated supernatant was stored in 200 µL aliquots at −80°C until further analysis.
-
bioRxiv - Developmental Biology 2020Quote: ... 3-5 colonies were picked and incubated in 2mL Terrific Broth (T0918, Sigma) containing 100µg/mL Ampicillin for 8 hours ...
-
bioRxiv - Neuroscience 2020Quote: ... TodoNeo1: 5’–CCG CTT TTC TGG ATT CAT CGA C–3’from SIGMA life science) ...
-
bioRxiv - Cancer Biology 2021Quote: ... or 3-(1,3-Benzodioxol-5-ylmethylene)-2-oxo-1-pyrrolidinecarboxaldehyde (KNK437, Sigma Aldrich) for 24 hours prior to collection of cells for RNA extraction.
-
bioRxiv - Biochemistry 2022Quote: ... or 100nM of synthetic RNA [45-mer: 5′ GGGUCAACGUGGGCAAAGAUGUCCUAGCAAGCCAGAAUUCGGCAG −3′] generated by Sigma. In reactions where CifA was co-present with CifB ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1µl of each primer (10µm, 5’: FAATGGCAGAGTGGGGTTGGG, 3’: CGGCAAACGGACAGAAGCATT, Sigma-Aldrich, USA).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Membranes were washed 3×5 min with 0.1% Tween® 20 (Sigma-Aldrich) in TBS before a 1 hour incubation with a 1:5,000 dilution of sheep anti-mouse IgG horseradish perodixase secondary antibody (GE Healthcare ...
-
bioRxiv - Microbiology 2021Quote: ... The probe used was as follows: 5’[6FAM]AGACTAATTCTCCTCGGCGGGCACG[TAM]3’ (Sigma Aldrich). Analysis was performed using the Rotor-Gene 6000 Series Software 1.7 (Corbett Life Sciences ...
-
bioRxiv - Neuroscience 2022Quote: ... and laminin for 3 hours at 37°C (5 μg/mL, Sigma L2020). To create single cell suspensions for plating aNSCs ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 dpf larvae were exposed to 3 μM CuSO4 (Sigma-Aldrich, Cat# 451677) diluted in EM in cell strainers (Corning ...
-
bioRxiv - Neuroscience 2022Quote: ... incubated in blocking solution (3% skimmed milk or 5% BSA (Sigma-Aldrich, A9647) in TBS + 0.01% Tween20 (Sigma ...
-
bioRxiv - Pathology 2023Quote: ... washed in TBS (3 × 5 min) and blocked in 1% BSA (Sigma Aldrich) in TBST (0.1% Tween-20 in TBS) ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.1 mM 8-bromoadenosine 3′,5′ cyclic monophosphate sodium salt (Sigma-Aldrich; “C”), and 0.1 mM 3-isobutyl-1-methylxanthine (IBMX ...
-
bioRxiv - Neuroscience 2023Quote: ... 3-(4,5-dimethylthiazol-2-Yl)-Diphenyltetrazolium Bromide (MTT, CT01-5, Sigma-Aldrich, UK) stock solution was diluted in F12 medium without phenol red (1:5) ...
-
bioRxiv - Genetics 2023Quote: ... beads were washed 3 times 5 minutes with lysis buffer (Sigma-Aldrich, L3412) on a rotator and protease and phosphatase inhibitors ...
-
bioRxiv - Cell Biology 2024Quote: ... and next 3 chamber volumes of 5 mg/ml κ-casein (Sigma, C0406) dissolved in MRB80 ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µL of Pellet Paint NF Co-precipitant (Sigma Millipore Cat. # 70748-3) and 500 µL of Sodium Acetate (pH 5.2 ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µL of Pellet Paint NF Co-precipitant (Sigma Millipore Cat. # 70748-3) and 500 µL of Sodium Acetate (pH 5.2 ...
-
bioRxiv - Cell Biology 2024Quote: ... Treated films were immediately incubated in 5% (3-Aminopropyl)triethoxysilane (APTES, Sigma, 440140) in ethanol (dark ...