Labshake search
Citations for Millipore Sigma :
751 - 800 of 10000+ citations for 6 Methyl benzo 1 3 dioxole 5 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... CHIR99021 (3 μM) and LY411575 (5 μM, Sigma-Aldrich, no. SML0506)].
-
bioRxiv - Genomics 2022Quote: ... PNP-GMP (guanosine 5′-[β,γ-imido]triphosphate, 3 mM, Sigma) was included in the lysis buffer of TIS(Ret ...
-
bioRxiv - Genetics 2023Quote: ... and 1µM adenosine 3’,5’-cyclic monophosphate (cAMP)(Millipore Sigma, #A9501). To aid in cell atachment ...
-
bioRxiv - Immunology 2023Quote: ... We implanted 5×105 EO771 (ATCC) or AT-3 (EMD Millipore) mouse mammary tumor cell lines and 1×105 mouse mammary fibroblasts orthotopically into 4th inguinal mammary fat pads of 6-8-week-old female C57BL/6J female mice (The Jackson Laboratory)(46) ...
-
bioRxiv - Cell Biology 2023Quote: ... cloned 5’-NdeI to 3’-NotI into pET21a(+) (Novagen, Madison, WI) (pET21a-APOL7C::FLAG::1XHis) ...
-
bioRxiv - Immunology 2024Quote: ... centrifuged for 5 min at 500 g (Centrifuge 3-18KS, Sigma), then resuspended in full media to a concentration of 1 × 106 cells/mL and distributed in 96-well plates (100 μL/well) ...
-
bioRxiv - Molecular Biology 2021Quote: A CU RNA hairpin (5’-AAAAGAAAAGACGCGUAGUUUUCUACGCG- 3’) labeled with Cyanine 5.5 at the 5’-end (Millipore Sigma) was annealed in 20 mM HEPES ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Polη (5’GCAAUGAGGGCCUUGAACA3’ from sigma-Aldrich) and Rev1 (5’CAGCGCAUCUGUGCCAAAGAA3’ from Sigma-Aldrich). For control ...
-
bioRxiv - Plant Biology 2023Quote: ... SD-WLH plates were supplemented with either 2.5 or 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich).
-
bioRxiv - Cancer Biology 2024Quote: ... 5’ – CACCGCCGCCTCCGCGCTTCCCCGA – 3’ PIEZO1_sgRNAact_TSS143 (guide 3): 5’ – CACCGAGGCCCCAACGCACCAGGGC – 3’ Modified U251 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; D5796, Sigma), supplemented with 10% foetal bovine serum (FBS ...
-
bioRxiv - Genomics 2019Quote: ... 1.5 g/L (days 0-5 and days 11-28) or 2.5 g/L (days 6-10) NaHCO3 (Sigma-Aldrich), and 0.25 mM (days 3-10 ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1.5 g/L (days 0-5 and days 11-14) or 2.5 g/L (days 6-10) NaHCO3 (Sigma-Aldrich), and 0.25 mM ascorbic acid (days 3-10) ...
-
bioRxiv - Immunology 2021Quote: ... or 0.5 μM/ml 5-amino-6-D-ribitylaminouracil (5-A-RU) (courtesy of Jeffrey Aubé, UNC) and 50 μM/ml Methylglyoxal (Sigma). Brefeldin A Solution (Biolegend ...
-
bioRxiv - Plant Biology 2019Quote: ... Inflorescences of each GUS line were pre-treated with ice cold acetone for 1h at −20°C and washed two times for 5 minutes with 100 mM sodium phosphate buffer followed by one wash with sodium phosphate buffer containing 1 mM K3Fe(CN)6 and 1 mM K4Fe(CN)6 (both Sigma) at room temperature ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimidehydrochloride (EDC) were procured from Sigma Aldrich, USA.
-
bioRxiv - Physiology 2019Quote: ... 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (Sigma-Aldrich, No. E7750) and an amide ...
-
bioRxiv - Plant Biology 2022Quote: ... and crosslinked using 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (Sigma). Biotin-labelled probes were hybridized with sRNAs on the nylon membrane and stabilized streptavidin-horseradish peroxidase was used to detect the biotin signal.
-
bioRxiv - Synthetic Biology 2023Quote: ... activated with 250mM 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Sigma)/ N-Hydroxysuccinimide (NHS ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3-[(3-Cholamidopropyl) dimethylammonio]-1-propanesulfonate hydrate (CHAPS) (C3023; Sigma Aldrich), and sodium dodecyl sulfate (SDS ...
-
bioRxiv - Immunology 2019Quote: ... inhibitors on the autophagic flux pathways (3-MA, 5 μM, Sigma-Aldrich; chloroquine, 5 μM, Sigma-Aldrich; bafilomycin, 5 μM, Sigma-Aldrich), and inhibitors on the mTOR pathway (Rapamycin ...
-
bioRxiv - Immunology 2019Quote: ... inhibitors on the autophagic flux pathways (3-MA, 5 μM, Sigma-Aldrich; chloroquine, 5 μM, Sigma-Aldrich; bafilomycin, 5 μM, Sigma-Aldrich), and inhibitors on the mTOR pathway (Rapamycin ...
-
Dopamine depletion can be predicted by the aperiodic component of subthalamic local field potentialsbioRxiv - Neuroscience 2021Quote: ... 4 or 8 μl of 6-OHDA (5 μg in 1 μl saline containing 0.1% ascorbic acid; Tocris, Bristol, ENG and Sigma-Aldrich, MA, USA) was injected into the left MFB at the following coordinates ...
-
bioRxiv - Neuroscience 2023Quote: ... then in the anti-dopamine receptor antibody diluted in the blocking solution for 5-6 days at 4°C (rabbit anti-dopamine D1A receptor, 1:100, Sigma-Aldrich AB1765P). Sections were washed in PBS and incubated for 2 h at RT in the secondary antibody (goat anti-rabbit Alexa Fluor 555) ...
-
bioRxiv - Neuroscience 2024Quote: Zebrafish larvae at 5 and 6 dpf were embedded in 1% low-melting temperature agarose diluted into MilliQ water (Sigma-Aldrich, USA). The fish were covered with artificial cerebro- spinal fluid (ACSF ...
-
bioRxiv - Cell Biology 2020Quote: ... acetylated tubulin (mouse, 6-11B-1, Sigma-Aldrich), ARL6 (rabbit ...
-
bioRxiv - Biochemistry 2022Quote: ... and 1μM 6-Mercapto-1-Hexanol (MCH, Sigma). The chip was rinsed for three times with 1× PBS buffer to remove unbound aptamers ...
-
bioRxiv - Cell Biology 2022Quote: ... G-6-PDH (Sigma-Aldrich, A9521; 1:5000), Adh1 (Calbiochem ...
-
bioRxiv - Molecular Biology 2019Quote: ... at 1 µg/ml or 6-thioguanine (Sigma) at 30 mM ...
-
Rac1, Rac3 GTPases and TPC2 are required for axonal outgrowth and migration of cortical interneuronsbioRxiv - Neuroscience 2022Quote: ... 6-diamidino −2-phenylindole (DAPI) (1:2000, Sigma).
-
bioRxiv - Neuroscience 2023Quote: ... clone GS-6 (Millipore-Sigma #MAB302, 1:1000) at 4 °C overnight or rabbit anti-HA (Invitrogen #MA5-27915 ...
-
bioRxiv - Neuroscience 2023Quote: ... clone GS-6 (Millipore-Sigma #MAB302, 1:1000) at 4 °C overnight or rabbit anti-HA (Invitrogen #MA5-27915 ...
-
bioRxiv - Bioengineering 2021Quote: ... 1.5 µL g-1 solution of the photoinitiator 2-hydroxy-2-methyl propiophenone (Irgacure 1173; >97 %, Sigma-Aldrich) was added at 4°C temperature ...
-
bioRxiv - Cell Biology 2021Quote: A solution of methimazole (1-methyl-3H-imidazole-2-thione) (CAS 60-56-0; MW: 114,17; Sigma-Aldrich) was used to induce hypothyroidism ...
-
bioRxiv - Neuroscience 2022Quote: ... mice were injected with the peripheral muscarinic antagonist scopolamine methyl nitrate (1 mg/kg s.c.; #S2250, Sigma Aldrich) to reduce the peripheral effects of pilocarpine ...
-
bioRxiv - Bioengineering 2020Quote: ... 1.5 μL g−1 hydrogel of the photoinitiator 2-hydroxy-2-methyl propiophenone (Irgacure 1173; >97 %, Sigma-Aldrich) were mixed in at a temperature of 4 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... the medium was changed to DMEM containing 10% FBS and 1 mM Methyl-o- nitropiperonyllysine (mNPK, Sigma-Aldrich) for #2-#4 ...
-
bioRxiv - Developmental Biology 2024Quote: ... The cells were washed with DPBS five times for 3 min each, and stained with 4’, 6-diamidino-2-phenylindole (DAPI, 1 μg/mL in PBS) (Sigma, San Francisco, CA, USA) in the dark at room temperature for 8 min ...
-
bioRxiv - Cell Biology 2021Quote: ... Ms anti-αTubK40ac (clone 6-11B-1, Sigma T7451; 1:10,000), Rb anti-giantin (Biolegend #924302 ...
-
bioRxiv - Cell Biology 2021Quote: ... and acetylated tubulin (1:20,000; clone 6-11B-1, Sigma Aldrich). HRP-conjugated goat anti-mouse IgG and goat anti-rabbit IgG were used for secondary antibodies (1:10,000 ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-acetylated-K40 6-11B-1 (1:500, Sigma-Aldrich), goat anti-HRP conjugated Alexa Fluor 647 (1:3000 ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-acetylated tubulin (1:200, clone 6-11B-1, Sigma Aldrich), and anti-CENTRIN1 (1:100 ...
-
bioRxiv - Immunology 2022Quote: ... and 1 ug/mL FSL-1 (TLR2/6 agonist, Sigma-Aldrich), or 6 X 105 cfu/mL E ...
-
bioRxiv - Cell Biology 2023Quote: ... monoclonal mouse acetylated tubulin (clone 6-11B-1, Sigma; 1:1000), polyclonal rabbit alpha tubulin (Abcam ...
-
bioRxiv - Cell Biology 2023Quote: ... anti acetylated α-tubulin (clone 6-11B-1, 1:500; Sigma); anti-Shot (1:1000 ...
-
bioRxiv - Neuroscience 2024Quote: ... acetylated tubulin (1:10000, clone 6-11B-1, T6793, Sigma-Aldrich) or α-tubulin (1:1000 ...
-
bioRxiv - Bioengineering 2021Quote: ... Measurements were done with respect to a reference 5(6)-carboxytetramethylrhodamine (TMR) (Sigma-Aldrich) in water.
-
bioRxiv - Immunology 2020Quote: ... Mice were fasted for 6 hours and 200 μl of 5% Evans blue (Sigma) in 5% gum arabic (ACROS organics ...
-
bioRxiv - Cancer Biology 2024Quote: The following reagents were used: 6-diazo-5-oxo-L-norleucine (DON) (D1242, Sigma); 2-acetyl-1,3-cyclopentanedione (ACPD ...
-
bioRxiv - Neuroscience 2023Quote: ... and 10-5 M CNQX (6-cyano-7-nitroquinoxaline-2,3-dione, C127; Sigma-Aldrich).
-
bioRxiv - Cell Biology 2023Quote: ... diluted in pre-warmed 5 mM K3[Fe(CN)6] (P-8131, Sigma-Aldrich), 5 mM K4[Fe(CN)6]·3H2O (P-3289 ...