Labshake search
Citations for Millipore Sigma :
9901 - 9950 of 10000+ citations for Recombinant Human Pentraxin 3 Long His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... was also placed into 7 M Guanidium HCl using three successive concentrations and dilutions using a centrifugal concentrator (3 K MWCO, Amicon Ultra-4, Millipore), and diluted to 2 mg/mL ...
-
bioRxiv - Biophysics 2021Quote: ... Free dye was removed from the labeled proteins by successive concentrations and dilutions using a 3 K MWCO centrifugal concentrator (Amicon Ultra-4, Millipore). The labeling efficiency was computed by measuring the concentration of the protein and Cy3 dye using their absorbances at 280 nm and 550 nm ...
-
bioRxiv - Cancer Biology 2020Quote: ... lentiviral vectors expressing the shRNA targeting PAT4 were produced as follows: HEK293T cells were co-transfected with shRNA-PAT4 plasmid DNA (5’-CCGGCCTTGATAAATGAGCAGAATTCTCGAGAATTCTGCTCATTTATCAAGGTTT TTG-3’; TRCN0000043984; Sigma) or new shRNA lentivirus (GTTGTCCTTATTGGAGATTC ...
-
bioRxiv - Cancer Biology 2020Quote: ... Pellets containing 3-5 million cells were prepared and frozen at −80°C in albumin/DMSO (90/10, Sigma-Aldrich). Note that the wild-type for both BRAF and NRAS (WT ...
-
bioRxiv - Immunology 2021Quote: ... The animals were then subjected to increasing doses of methacholine (0.1, 0.3, 1, 3, 10, 30mg/mL) (a broncho-constrictor; acetyl-β methacholine chloride; Sigma-Aldrich) delivered by an ultrasonic nebuliser ...
-
bioRxiv - Genomics 2021Quote: ... Cells were pelleted at 600 g for 3 min and resuspended in 400 μl Wash Buffer 1 (wash buffer with 0.05 % saponin (Sigma Aldrich), protease inhibitor cocktail (Sigma Aldrich) ...
-
bioRxiv - Immunology 2021Quote: SARS-CoV-2 isolate nCoV-WA1-2020 (MN985325.1)49 (Vero passage 3) was kindly provided by the CDC and propagated once in VeroE6 cells in DMEM (Sigma) supplemented with 2% fetal bovine serum (Gibco) ...
-
bioRxiv - Neuroscience 2020Quote: ... from 6-week-old B6.Cg-Tg(Thy1-YFP)16Jrs/J male and female mice were plated on Transwell inserts (Grenier Thincerts, 3 μm porosity) coated with 10 μg/ml laminin (Sigma). Mitotic inhibitors ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 3 birds (henceforth SP-treated birds) had a daily subcutaneous injection of 30 µl of a sulfadoxine-pyrimethamine solution (Sigma S7821 and 46706 ...
-
bioRxiv - Microbiology 2021Quote: ... The hSPLUNC1 coding sequence with a 3’ sequence encoding the FLAG tag was amplified from cDNA using KOD polymerase (Sigma) and the primers (Forward ...
-
bioRxiv - Neuroscience 2020Quote: ... before being rehydrated in milliQ water for 3 min and incubated with preheated 0.3% black-gold II stain (Millipore, AG105) at 60°C for 30 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4°C) twice with 300 μL of Elution buffer (Lysis buffer A with 1 mg/mL 3 × FLAG peptide (Sigma)) ...
-
bioRxiv - Biochemistry 2020Quote: ... Bound protein was eluted seven times with 0.5 column volumes of buffer A with 3 mM D-Desthiobiotin (Sigma-Aldrich), 0.026% DDM and 0.1 mM AEBSF protease inhibitor ...
-
bioRxiv - Biochemistry 2020Quote: The S-variant and RBD coupled bead sets were incubated with SARS-CoV-2 patient sera at 3 dilutions (1/100; 1/1000 and 1/10000) for 1 h in 96-well filter plates (MultiScreenHTS; Millipore) at room temperature in the dark on a horizontal shaker ...
-
bioRxiv - Biochemistry 2020Quote: ... which was followed by the addition of NH4HCO3 (1 M, 3 μl, freshly made) and Calf Intestinal Alkaline Phosphatase (1 U, Sigma) and additional incubation at 37 °C for 2 h ...
-
bioRxiv - Bioengineering 2021Quote: ... the precursor solution for the Zn0.4Fe2.6O4 nanoparticles was prepared at a con-centration of 0.2 molZn+Fe / L in a 3:1 volume ratio of xylene and acetonitrile (both Sigma-Aldrich). Iron acetylacetonate (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2021Quote: ... we incubated them with suspended lentiviral solutions (MOI 3-5) for 24 h with 4 µg/mL polybrene (Sigma-Aldrich) before we replaced the medium with refresh culture medium ...
-
bioRxiv - Bioengineering 2021Quote: ... 200 mg Ru(dpp)3(ClO4)2 complex was dissolved in 10ml ethanol (ACS reagent ≥99.5%, CAS 459844; Sigma-Aldrich). Silica gel was prepared by adding 2 g silica particles to 40 ml aqueous NaOH (0.01N ...
-
bioRxiv - Bioengineering 2020Quote: ... Cells were centrifuged again for 3 min at 300 rcf and blocked with staining buffer (FACS buffer containing 0.5% Tween20 (Sigma, P2287)) for 15 min at RT in the dark ...
-
bioRxiv - Biochemistry 2021Quote: ... were mixed with 3 µl proteinase K (20 mg/ml in 25 mM Tris-HCl, 5 mM Ca2Cl, pH 8.0, Sigma-Aldrich). This mixture was applied to the ear clips ...
-
bioRxiv - Biochemistry 2020Quote: ... The recovery of RNase A activity was measured by monitoring the linear increase in absorbance at 295 nm on a U-3900 spectrophotometer (HITACHI) at 30°C after addition of 1.25 mM cytidine 2′,3′-cyclic monophosphate monosodium salt (cCMP, Sigma-Aldrich) to reaction mixtures at indicated time points.
-
bioRxiv - Biochemistry 2020Quote: ... The PLL-dye conjugates were purified by filtration through Amicon Ultra-0.5 mL centrifugal filters with a molecular weight cutoff (MWCO) of 3 kDa (Millipore Sigma). The final concentration of PLL was determined with a bicinchoninic acid (BCA ...
-
bioRxiv - Biophysics 2021Quote: Fractions were assessed by SDS-PAGE and pooled for dialysis in 3.5 kDa MWCO dialysis tubing (SpectraPor 3 Dialysis Membrane, Sigma Aldrich). For all variants except CLC ...
-
bioRxiv - Neuroscience 2021Quote: Synaptosomes were prepared from the striatum or cortex of VGLUT1venus or DAT-Cre eGFP-expressing mice by homogenization in 1ml of ice-cold isosmolar buffer (0.32M sucrose, 4 mM HEPES pH7.4, protease inhibitor cocktail Set 3 EDTA-free (EMD Millipore Corp.)) ...
-
bioRxiv - Neuroscience 2021Quote: ... and aphidicolin (7.5µM) before cells were treated for 3 hours with nutrients (1 µM insulin plus 0.8 mM L-leucine [Sigma Aldrich catalog numbers I5500 and L8000 ...
-
Peripheral CB1 receptor blockade acts as a memory enhancer through an adrenergic-dependent mechanismbioRxiv - Neuroscience 2021Quote: Free-floating brain slices were rinsed in PB and blocked in a solution containing 3 % donkey serum (DS) (Sigma-Aldrich) and 0.3 % Triton X-100 (T ...
-
bioRxiv - Biochemistry 2021Quote: ... and 4) the substrate solution (nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate, Sigma-Aldrich, St. Louis, MO). Other details were as described previously [Duk M. ...
-
bioRxiv - Microbiology 2021Quote: ... The anterior portion was immediately placed into a HPF 3 mm specimen carrier with 20% bovine serum albumin (Sigma-Aldrich) and frozen in an Alba HPM 010 ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then incubated in B2 with 2% nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl-phosphate (NBT/BCIP, Sigma) until adequate colour development ...
-
bioRxiv - Biophysics 2021Quote: D-glucose and 3-O-methyl-D-glucose powder for in vitro studies were obtained from Sigma-Aldrich (Milan, Italy). Solutions of D-glucose and 3OMG for in vitro studies were prepared in 10 mM phosphate-buffered saline (PBS 1X) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 50mM Tris pH 8.0 and cOMPLETE™ Mini protease inhibitor cocktail (#11836153001) and phosphatase inhibitor cocktail 2 and 3 (Sigma) for lysis ...
-
bioRxiv - Cell Biology 2021Quote: ... followed by a washout into thymidine free media for 3 hours prior to the addition of Taxol (250 nM; Sigma) for 15 hours ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were seeded into 6-well plates to reach 50-60% confluency on the day of infection and were transduced 2-3 consecutive days with the viral supernatant in the presence of 8 μg/mL polybrene (Sigma). The viral supernatant was replaced with fresh culture medium ...
-
bioRxiv - Plant Biology 2021Quote: ... PVDF membranes were blocked with 5% milk followed by an incubation with first antibodies for REM1.2/1.3 followed by 3 washes and an incubation with second α-rabbit antibody fused to HRP against rabbit (Sigma). Clarity Western 701 ECL (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... SP cells lacking endogenous mRNA were resuspended (3×106 SP cells/mL as determined by trypan blue (Sigma-Aldrich, T8154) staining ...
-
bioRxiv - Biochemistry 2020Quote: ... nicotinic acid (cat. N4126), 2-aminopyridine-3-carboxylic acid (cat. A68300) and 1,1′-Carbonyldiimidazole (CDI, cat. 21860) were purchased from Sigma Aldrich. For the synthesis of NAI ...
-
bioRxiv - Cell Biology 2021Quote: ... were reared in 10g/l of glucose/200µM of 3BDO (3-Benzyl-5-((2-nitrophenoxy) methyl)-dihydrofuran-2(3H)-one) (Sigma Aldrich) supplemented in standard fly food ...
-
bioRxiv - Cell Biology 2021Quote: ... at 37°C in the presence of Zombie Red (1/1000) according to the manufacturer’s procedure (Ozyme) then trypsinized and fixed in PBS with formalin 3% (Sigma Aldrich). For F-actin quantification ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were infected with HIV-1NL4-3 or HIV-1JRFL (PM1-CCR5) and cultured in RPMI 1640 medium (Sigma-Aldrich) supplemented with 10% fetal calf serum (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2020Quote: ... Complementation of the lasR-less phenotype was done in the presence and absence of 5 μM 3-Oxo-C12-HSL (Sigma) and pyoverdine ...
-
bioRxiv - Plant Biology 2021Quote: ... green tissues of 2- to 3-week old plants were sprayed until drop-off with 1 mM SA (Sigma Aldrich), 100 μM MeJA (Sigma Aldrich) ...
-
bioRxiv - Plant Biology 2020Quote: ... To remove residual boric acid the medium was treated overnight with B chelator Amberlite IRA-743 (3 g/L, Sigma). Before autoclaving ...
-
bioRxiv - Neuroscience 2020Quote: ... The plates were later washed with sterile distilled water 3 times and incubated with 250 μl of 50 μg/ml fibronectin (Sigma) overnight at 4°C until further neuronal culturing.
-
bioRxiv - Neuroscience 2020Quote: ... 5 ml of lysis buffer (10 mM Tris, 10 mM NaCl, 3 mM MgCl2, 0.1% Nonidet P40 substitute (Roche/ Sigma, 11754599001), 0.2 U μl−1 RNase inhibitor ...
-
bioRxiv - Neuroscience 2020Quote: Mice were intraperitoneally injected with 3 doses of LPS dissolved in 0.1 mol phosphate balanced solution (PBS) (Escherichia coli O111: B4; Sigma-Aldrich) (50μg/kg bodyweight for each dose; ...
-
bioRxiv - Neuroscience 2020Quote: ... the sections were incubated 1-3 overnights at 4°C in the following primary antibodies: goat anti-choline acetyltransferase (1:200; Millipore), rabbit anti-substance P (1:500 ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were transfected using X-tremeGENE 9 (ratio 3:1 μl/μg DNA) according to the manufacturer’s protocol (Sigma-Aldrich). DNA encoding PAC constructs and SthK-EGFP was used at a 3:1 ratio ...
-
bioRxiv - Physiology 2021Quote: ... EDL muscles were digested in Krebs solution (without FCS) containing 3 mg/ml collagenase type IV A (Sigma Aldrich, USA), gently bubbled with carbogen (95% O2 ...
-
bioRxiv - Microbiology 2021Quote: ... glucose were pelleted by centrifugation and resuspended in 5 mL YNBNAG11 pH 5.1 containing 5 μM 3-MB-PP1 (EMD MILLIPORE) or DMSO as a vehicle control ...
-
bioRxiv - Neuroscience 2020Quote: ... The sections were first washed 3×10min with PBS and then permeabilized with 0.1% Triton X-100 (T9284, Sigma-Aldrich) in PBS for 10 min at room temperature (RT) ...