Labshake search
Citations for Millipore Sigma :
9651 - 9700 of 9891 citations for SUMO2 3 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... A total of 10 M cells were used per each replicate of library and 3 µg of anti-CTCF antibody (Sigma-Aldrich, 07-729) was used for o/n chromatin immunoprecipitation at 4°C ...
-
bioRxiv - Developmental Biology 2023Quote: Zebrafish larvae were anesthetized with 1 mg/ml Tricaine and transferred to a 6-well glass-bottom plate containing 3% methylcellulose (Sigma-Aldrich, MO, USA) in E3 medium ...
-
bioRxiv - Cancer Biology 2023Quote: ... followed by transduction with LV at MOI 3 in the presence of 8 µg/ml Hexadimethrine bromide (Sigma-Aldrich, St. Louis, MO, USA) the following day ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were washed with 0.05% Tween-20 in phosphate buffered saline (PBST) for 3 × 5 min with agitation and incubated with anti-β actin (1:1000 rabbit polyclonal (Sigma Aldrich; A2066) or 1:5000 mouse monoclonal (Sigma Aldrich ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... was purchased from Pfaltz and Bauer (Item #: M19160) and ?99% 4-methyl-3-heptanol (mixture of stereoisomers) was purchased from Sigma-Aldrich (Item #: M48309). Compounds were freshly diluted on each day of behavioral experiments ...
-
bioRxiv - Neuroscience 2023Quote: The viability of SH-SY5Y cells after indicated treatments was evaluated using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) assay ...
-
bioRxiv - Physiology 2023Quote: ... cardiac mitochondria isolated from 3-5 pooled hearts of each genotype were lysed on ice for 30 min in 1X RIPA buffer (EMD Millipore #20-188) supplemented with 1X protease inhibitors (Sigma-Aldrich #S8830-20TAB) ...
-
bioRxiv - Plant Biology 2023Quote: ... 1.5-ml glass vials (Ø×H 11.6 × 32 mm) containing ∼ 100 mg glass wool were filled with 200 µl (Z)-3-hexenyl acetate (HAC, >98%, Sigma-Aldrich, Buchs, Switzerland) and sealed with screw caps containing a rubber septum ...
-
bioRxiv - Cancer Biology 2023Quote: ... were deparaffinized and then subjected to antigen retrieval for 10 minutes at 121 uC at 15 PSI in 2.94 g/L sodium citrate (pH 6; Sigma Aldrich, 61332-04-3). Sections were permeabilized in PBS with 0.4% Triton X-100 (PBT ...
-
bioRxiv - Biochemistry 2023Quote: ... SP3 beads were then resuspended in 100 μL of 200 mM HEPES (pH 7.5) and digested overnight at 37 °C with Solu-trypsin (3 µg solu-trypsin, Sigma, trypsin:protein ratio 1:33). The resulting peptide mixtures were collected using a magnetic rack ...
-
bioRxiv - Plant Biology 2023Quote: ... GAA microsatellites on the isolated chromosomes were labelled by fluorescence in situ hybridization in suspension (FISHIS) using 5’-FITC-GAA7-FITC-3’ oligonucleotides (Sigma, Saint Louis, USA) according to (10 ...
-
bioRxiv - Neuroscience 2023Quote: The low glucose starvation medium was composed of 3:1 medium supplemented with an additional 10% heat-inactivated FBS (Millipore, #es‒009‒b), N2 supplement (GIBCO ...
-
bioRxiv - Pathology 2023Quote: ... The solvent (n=5) or an FXIa inhibitor (ONO-1600586, 3 µmol/L n=5) and mepacrine (Sigma-Aldrich; final concentration 5 µM) were added to the blood before perfusion ...
-
Juxtacrine DLL4-NOTCH1 signaling between astrocytes drives neuroinflammation via the IL-6-STAT3 axisbioRxiv - Neuroscience 2023Quote: ... the pellet was washed 3 times with the buffer B and filtered through a 100 µm nylon mesh (Millipore Corporation, Burlington, MA, USA). The nylon mesh was washed with 7 mL of buffer B to collect the retained enriched neurovascular fractions ...
-
bioRxiv - Physiology 2023Quote: ... In order to substitute cholesterol in the patch with cholest-4-en-3-one (cholestenone) the bath solution was replaced with 2 mM MBCD solution saturated with cholest-4-en-3-one (Millipore-Sigma, St. Louis, MO).
-
bioRxiv - Genomics 2023Quote: ... 10 mL ATCC vitamin supplement and 1 mL vitamin K-3 solution (0.14 g vitamin K-3 in 100 mL 95% ethanol)24 reduced by the addition of 50% Oxyrase (SAE0013; Sigma, St. Louis, MO) were added in an anaerobic chamber ...
-
bioRxiv - Genomics 2023Quote: ... The membrane is washed again with 1x TBST solution, and then incubated the primary antibody solution (3% BSA in TBST, 1:250 anti-HA (Sigma-Aldrich, A2095-1ML), 1:500 anti-FLAG (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: ... larvae were washed thrice in PBS containing 0.5% Triton X-100 (PBST) for 5 minutes and blocked with PBST containing 3% (w/v) Bovine Serum Albumin (Sigma-Aldrich, Gillingham, UK) for 1 h ...
-
bioRxiv - Cell Biology 2023Quote: ... the cells were permeabilized with 0.2% Triton X-100 (Nacalai Tesque, Kyoto, Japan) for 15 minutes and blocked with 3% bovine serum albumin (BSA: Sigma Aldrich, MO, USA) for 30 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2-4 months old mice were orally gavaged with 3 x 2 (Mist1creERT/+KRASG12D/+) or 5 x 5 mg (Ptf1acreERT/+KRASG12D/+) of tamoxifen (TX; Sigma-Aldrich, T5648-5G) at Western University and 5 x 4 mg (Ela-creERT ...
-
bioRxiv - Biophysics 2023Quote: ... Lipid fluorophore 1,2 – Dioleoyl-sn-glycero-3-phosphoethanolamine labeled with Atto 647 (Atto 647 DOPE) was purchased from Sigma Aldrich (St. Louis, MO). Thapsigargin was used at 2 μM (AC328570010 ...
-
bioRxiv - Biophysics 2023Quote: ... the sample was resuspended in 100 μL 1 x DPBS and incubated for 1 hour in the dark with ∼ 3 μL of the MPM-2 antibody (anti-phospho-Ser/Thr-Pro, Cy5 conjugate) (Millipore, Sigma-Aldrich, USA) that stains cells containing mitosis-specific phophorylations ...
-
bioRxiv - Neuroscience 2023Quote: ... free-floating sections were blocked in 1% H2O2 and 3% bovine serum albumin (BSA, Cat. No. D5637, Sigma-Aldrich, St. Louis, Missouri, USA). Pons sections were stained with Hematoxylin and Eosin (H&E ...
-
bioRxiv - Neuroscience 2024Quote: ... Chilled lysis buffer (10 mM Tris-HCl, 10 mM NaCl, 3 mM MgCl2, and 0.1% Nonidet™ P40 Substitute (Sigma Aldrich, PN-74385) was added to the tissue and the tube was incubated on ice for 15 min with gentle shaking during the incubation ...
-
bioRxiv - Microbiology 2024Quote: ... a collagen raft mixture was prepared on ice via combining 3 mg/ml collagen with 10X E-Media (Powdered DMEM (Millipore Sigma, D7777-10L), powdered Ham’s F-12 (Millipore Sigma ...
-
bioRxiv - Biophysics 2024Quote: ... The eluate protein from NiNTA columns was buffer exchanged into PBS pH 7.4 and concentrated with a 3 kDa Amicon® Ultra-4 Centrifugal Filter Units (Millipore Sigma Cat# UFC800308). Proteins were frozen and stored at -80 °C.
-
bioRxiv - Biochemistry 2024Quote: ... The flow-through and washes were then pooled and concentrated using a concentrator with a 3 kDa molecular weight cut-off (Millipore, Burlington, MA, USA) and the protein was filtered through polyvinylidene fluoride ultra-free membrane filter with a 0.22 μm pore size (Millipore) ...
-
bioRxiv - Plant Biology 2024Quote: ... medium lacking Trp but containing 40 μg mL-1 5-bromo-4-chloro-3-indolyl-α-D-galactopyranoside (X-α-gal; Sigma‒Aldrich) at 30°C for 3 days ...
-
bioRxiv - Microbiology 2024Quote: ... Membrane protein topology was assayed by plating the resulting reporter strains on dual-indicator plates containing LB agar supplemented with 80 μg/ml 5-bromo-4-chloro-3-indolyl phosphate disodium salt (X-Phos) ([Sigma Aldrich], RES1364C-A101X) and 100 μg/mL 6-chloro-3-indolyl-β-d-galactoside (Red-Gal ...
-
bioRxiv - Bioengineering 2024Quote: ... Metabolic and mitochondrial activity of host cells was assessed with a resazurin assay (7-Hydroxy-3H-phenoxazin-3-one-10-oxide sodium salt, Sigma-Aldrich, Overijse, Belgium). Medium was refreshed with 1 mL of 0.01 mg/mL resazurin in DMEM and incubated for 2 h at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... S% C02 in DMEM supplemented with 40 μM BrdU/BrdC (ratio 3:l, BrdU: BS002, Sigma-Aldrich, BrdC: sc-284SSS, Santa Cruz Biotech). Degradation of EGFP-AID-STAG2 was induced by the addition of S00 µM Inole-3-acetic acid (IAA ...
-
bioRxiv - Immunology 2024Quote: ... The aorta was dissected circumferentially away from the surrounding tissues and subjected to 3 minutes of either 5 µL of peri-adventitial elastase (0.4 U/mL type 1 porcine pancreatic elastase, Sigma Aldrich, St. Louis, MO) or heat-inactivated elastase as control ...
-
bioRxiv - Developmental Biology 2024Quote: 20-hydroxyecdysone (20-E, CAS-number: 5289-74-7) and cucurbitacin B (CucB, CAS-number: 6199-67-3) were obtained from Sigma-Aldrich (MA, USA). Based on our preliminary tests to check for lethal or critical effects on development ...
-
bioRxiv - Plant Biology 2020Quote: ... of internode above and below the node was selected for in vitro culture on the MS-0 medium with 3 gL−1 Phytagel (Sigma Chemical Co., St. Louis) and no plant growth regulator ...
-
bioRxiv - Cell Biology 2020Quote: ... were cultured from separated dental papilla tissues of P1 tooth germs following digestion with 3 mg/ml collagenase I (Sigma, St. Louis, MO, USA) for approximately 45min at 37C ...
-
bioRxiv - Immunology 2021Quote: ... The membrane was blocked using 1x TBST+ 3% Casein followed by overnight incubation at 4°C with biotinylated Lectin from Triticum Vulgaris (Sigma/Merck Cat. No. L5142). The membrane was washed with 1XTBST and further Incubated with Streptavidin PerCP-eFluor710 Conjugated ...
-
bioRxiv - Molecular Biology 2019Quote: ... Whole blood (3 mL) was collected by venipuncture into syringes containing acid citrate dextrose solution (ACD) (Sigma Aldrich, St. Louis, MO, USA. Cat #: C3821).
-
bioRxiv - Neuroscience 2021Quote: Protein lysates were extracted from the hippocampi or cortices of adult mice and dissected in ice-cold PBS containing Phosphatase Inhibitor Cocktails 2 and 3 (Sigma-Aldrich, St. Louis, MO) and Mini-Complete Protease Inhibitor Cocktail (Roche Diagnostics ...
-
bioRxiv - Neuroscience 2021Quote: ... for 15 min each (30%, 50%, 75%, 90%, 3× 100%) and incubated with increasing concentrations of the epoxy resin Durcupan (Sigma-Aldrich, St. Louis, USA) (2:1 ...
-
bioRxiv - Genomics 2019Quote: ... partheno-sporophyte material was chemically cross-linked for one hour at RT using formaldehyde (final concentration: 3% in 1X PBS; final volume: 30 ml; Sigma-Aldrich, St. Louis, MS). The formaldehyde was then quenched for 20 min at RT by adding 10 ml of 2.5 M glycine ...
-
bioRxiv - Genomics 2020Quote: ... an oligonucleotide was designed based on sequences of the telomeric satellite albi_telomere1: GTTCCTATAGCTTCTCTCACTCAAGTAGCCT and labelled with 3’-end-Cyanine3 fluorochrome (Sigma-Aldrich, St. Louis, MO, USA) The sequence of the oligonucleotide probe is AGGCTACTTGAGTGAGAGAAGCTATAGGAAC [Cyanine3] ...
-
bioRxiv - Microbiology 2019Quote: ... Resuspended cell pellets were then transferred to 2 ml FastPrep tubes containing ca 500 μl of a 3:1 (w/w) glass bead mixture of bead sizes 106 μm (Sigma Aldrich, product no. G4649) and 425-600 μm (Sigma Aldrich ...
-
bioRxiv - Systems Biology 2019Quote: ... chloroform extraction and the resulting mixture were dried down under nitrogen and derivatised with 100 µL of 3 M butanolic-HCl (Sigma-Aldrich, Louis, Missouri, USA). Samples were evaporated under nitrogen ...
-
bioRxiv - Microbiology 2019Quote: ... The cells were cultured at 37 °C in Leibovitz (L-15) medium supplemented with 3% newborn calf serum and a 1% mixture of Penicillin and glutamine (Sigma-Aldrich, Prague, Czech Republic). BHK-21 cells (obtained from the American Type Culture Collection [ATCC]) ...
-
bioRxiv - Pathology 2019Quote: ... adult donor mice were first injected intraperitoneally once per day for 3 consecutive days with 50 mg/kg of phenylhydrazine (Sigma Aldrich, cat. number 114715) to induce anemia ...
-
bioRxiv - Neuroscience 2019Quote: Pectoral fins were amputated from wild-type larvae anesthetized in 0.02% ethyl-3-aminobenzoic acid ethyl ester (MESAB, Sigma-Aldrich E10521, St. Louis, MO). Pairs of anesthetized ...
-
bioRxiv - Neuroscience 2020Quote: CSF samples were prepared for NMR by adding 16 µL 3-(Trimethylsilyl)-1-propanesulfonic acid-d6 sodium salt (DSS-D6; Chenomix/Sigma-Aldrich, Oakville, ON, Canada) to 30 µL CSF (pooled from 1 – 3 animals ...
-
bioRxiv - Bioengineering 2020Quote: ... or covalently crosslinked with 75 mM of dihydrazide (AAD)/1-hydroxybenzotriazole (HOBT) with 100 mg/mL of 1-ethyl-3- (dimethylaminopropyl) carbodiimide (EDC) (all from Sigma-Aldrich, St. Louis, MO) (Table 1) ...
-
bioRxiv - Neuroscience 2021Quote: ... the four-month-old APP/PS1 mice under vitamin D3-sufficient diet condition were intraperitoneally injected weekly with 3 mg/kg of p53 inhibitor Pifithrin-α (PFTα, Sigma-Aldrich, Cat# P4359) for 3 months before harvesting hippocampal tissues for analysis ...
-
bioRxiv - Physiology 2020Quote: ... Cells were incubated at RT for 3 hrs in 300 μl secondary antibody solution containing anti-rabbit TRITC (Sigma-Aldrich Cat# T6778, RRID: AB_261740) at a concentration of 1:75 in 1× TBS ...