Labshake search
Citations for Millipore Sigma :
9251 - 9300 of 10000+ citations for 6 PHENYL 1 3 DIHYDRO INDOL 2 ONE since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... RBCs depleted splenocytes from these mice were ex vivo stimulated with F(ab’)2 anti-Kappa (1 ug/ml, Sigma-Aldrich) and (or ...
-
bioRxiv - Biochemistry 2023Quote: ... Immunoprecipitation was carried out by mixing 500-800 µg of whole cell lysate and 1-2 µg of anti-Flag M2 antibody (Sigma Millipore, #F3165), 1-2 µg of anti-c-Myc antibody (Santa Cruz Biotechnology ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were mounted in 3D homemade printed chambers covered with coverslips and sealed with a melted paraffin–vaseline mixture (∼2:1 ratio) (Cat. #: P3558, Sigma-Aldrich. Vaseline pure ...
-
bioRxiv - Neuroscience 2023Quote: ... A high-titre solution of viral vector (AAV9-syn-jGCaMP7f-WPRE) was diluted to a final ratio of 2:1 with a 20% mannitol solution (Sigma-Aldrich) to promote diffusion ...
-
bioRxiv - Immunology 2023Quote: ... 3-4 and 7-9 were treated with 100 µL of embryo water plus 1 µg/mL 2′,7′-Dichlorofluorescein diacetate (H2DCFDA) (Sigma-Aldrich) in 0.4% DMSO ...
-
bioRxiv - Developmental Biology 2023Quote: ... samples were cleared using a 1:2 mixture of Benzyl Alcohol: Benzyl Benzoate (108006, B6630, Sigma-Aldrich, St. Louis, MO, USA).
-
bioRxiv - Developmental Biology 2023Quote: ... samples were dehydrated in series of Methanol and cleared using BABB (a mixture of 1 part benzyl alcohol to 2 parts benzyl benzoate; Sigma-Aldrich, benzyl alcohol ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lysates were normalized in Buffer A with 1% SDS and prepared with 6X Laemmli sample buffer containing 100 mM 2-mercaptoethanol (Sigma M6250). Lysates were separated on 4-12% BoltTM Bis-Tris gels (Invitrogen ...
-
bioRxiv - Developmental Biology 2023Quote: ... the samples were washed in 100% methanol for 1.5 h and cleared in BABB (1:2, benzyl alcohol:benzyl benzoate) (Sigma-Aldrich, 108006, B6630).
-
bioRxiv - Bioengineering 2023Quote: ... Cells were plated in serum-free growth medium (SFGM, Supplementary Table 1) on fibronectin-coated (4 μg cm-2 bovine fibronectin; F1141, Sigma-Aldrich) tissue culture vessels ...
-
bioRxiv - Bioengineering 2023Quote: To generate emulsions, 1 mL of fluorinated oil (Novec 7500, ACOTA) and 2 mL of protein solution (β-lactoglobulin; >90%, Sigma, from bovine milk ...
-
bioRxiv - Paleontology 2023Quote: All aqueous solutions were prepared from ultrapure grade water obtained by water filtration with a two stages Millipore system (Milli-Q® Academic with a cartouches Q-Gard 1 and Progard 2, Merck Millipore, Burlington ...
-
bioRxiv - Cancer Biology 2023Quote: ... Stable KD of EIF4G2 was generated by infecting HEC-1A or RL95-2 cells with lentiviruses harboring pLKO.1-puro plasmid expressing shRNA targeting GFP (Control) or shRNA targeting EIF4G2 (Sigma TRCN0000147914), followed by selection using puromycin ...
-
bioRxiv - Neuroscience 2024Quote: ... in saline solution 2 ml of Evans blue albumin (EBA, 5% bovine albumin labelled with 1% Evans blue; molecular weight: 68 kDa, Sigma Chemicals) for 1 h.[2] Finally ...
-
bioRxiv - Neuroscience 2024Quote: ... third-instar larvae were dissected in ice-cold larval Ringer’s solution with a 1:100 dilution of phosphatase inhibitor cocktail 2 (Sigma-Aldrich, P5726). Tissues were fixed in 4% paraformaldehyde with 1:100 phosphatase inhibitor cocktail 2 in PBS for 60 minutes at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... The cells were subsequently blocked with 2% BSA-PBS for 1 hour at room temperature and then stained with 5 µU/mL of phalloidin 568 (Sigma-Aldrich) for 1 hour at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were plated in serum-free growth medium (SFGM, Supplementary Table 1) on fibronectin-coated (4 μg cm-2 bovine fibronectin, F1141, Sigma-Aldrich) tissue cultureware.
-
bioRxiv - Microbiology 2024Quote: ... These cell lines were generated by the transduction with lentiviruses expressing the 2 subunits of a PARP-1-specific zinc-finger nuclease (Sigma, CKOZFN1116). Transduced cells were subjected to single cell-cloning ...
-
bioRxiv - Immunology 2024Quote: ... the samples were dehydrated with increasing methanol series and subsequently optically cleared in glass-bottom microwell dishes first with 50 % benzyl alcohol (Honeywell) 1:2 benzyl benzoate (BABB; Sigma–Aldrich) in methanol and then with 100 % BABB ...
-
bioRxiv - Neuroscience 2024Quote: ... Samples were transferred to BABB solution (1:2 ratio of benzyl alcohol, Sigma-Aldrich, 305197; and benzyl benzoate, Sigma-Aldrich, B6630) for three hours ...
-
bioRxiv - Bioengineering 2024Quote: ... Trans-2-[3-(4-tert-Butylphenyl)-2-methyl-2- propenylidene]malononitrile (DCTB) (100 mg mL-1 in ACN) was used as the matrix without further purification (Sigma-Aldrich). NaTFA salt was used as the ionization agent (1 mg mL-1 in MeOH) ...
-
bioRxiv - Cell Biology 2024Quote: Implanted SRA were iodinated by immersion overnight in 1.25% potassium triiodide (Chemondis, II0181) diluted 1:2 in 10% formalin (Sigma-Aldrich, HT501128). After washing with distilled water ...
-
bioRxiv - Systems Biology 2024Quote: Mouse ESCs were cultured for at least two passages on 0.1% gelatin and fed every 1-2 days with ESC medium consisting of DMEM (EMD Millipore SLM220B) supplemented with ESC-screened FBS (Hyclone SH30071.03E) ...
-
bioRxiv - Cell Biology 2024Quote: ... Horseradish peroxidase conjugated secondary antibodies (table 2) were added for 1 h at room temperature and protein signal was then visualized using Immobilon Forte (Millipore, WBLUF0500) on ImageQuant LAS 4000 or Amersham ImageQuant 800 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... bisphenol C-Cl (CAS no. 14868-03-2) and bisphenol S (CAS no. 80-09-1) were bought from Sigma-Aldrich. Compounds were dissolved in dimethyl sulfoxide (DMSO ...
-
bioRxiv - Genetics 2024Quote: ... Membranes were washed again twice with PBST and once with PBS followed by 1-2 min incubation in horseradish peroxidase substrate (Millipore, WBKLS0) before visualization using a Chemidoc MP imaging system (Bio-Rad Laboratories).
-
bioRxiv - Microbiology 2024Quote: ... The FTO-treated group was first denatured at 95 °C for 5 min and demethylated by incubating with 200 pmol of FTO and 1× FTO reaction buffer (2 mM sodium ascorbate (Sigma-Aldrich), 65 μM ammonium iron(II ...
-
bioRxiv - Microbiology 2024Quote: ... The labelling and purification of single or double labelled HSV-1 virions with 5-Ethynyl-2’-deoxycytidine (EdC; Sigma-Aldrich, T511307) and 7-Deaza-7-ethynyl-2’-deoxyadenosine (EdA ...
-
bioRxiv - Neuroscience 2024Quote: ... Sections were washed for 3 minutes (5 times) with cold PBS before being blocked for 1 hr in fish Gel Blocking Buffer (2% Fish Gel [Sigma-Aldrich G741-100G] ...
-
bioRxiv - Pathology 2024Quote: ... rinsed quickly in 1 change of acetic acid solution prior to mounting in 95% alcohol with 2 changes in Histoclear solution (Sigma-Aldrich) followed by mounting in synthetic resin ...
-
bioRxiv - Neuroscience 2024Quote: Sections were blocked using 10% donkey serum in 0.1% Triton X 100 in PBS and then stained with primary antibodies (Oxytocin Polyclonal Antibody, Invitrogen, Rabbit Polyclonal, Cat #PA5-26701, 1:1000 and Anti-Neurophysin 2/NP-AVP Antibody, clone PS 41, Millipore Sigma, Mouse Monoclonal ...
-
bioRxiv - Microbiology 2024Quote: ... an additional 1 mL of “Opti-MEM” containing 1% P/S/G and 0.2% BSA was supplemented with 2 μg/mL TPCK-treated trypsin (Sigma–Aldrich, USA). At 48–72 h post-addition of TPCK-treated trypsin ...
-
bioRxiv - Cell Biology 2024Quote: ... 100 μL protoplast was mixed with 20 μL DNA (1 – 2 μg total) and 50 μL ice-cold solution 4 (25 g of PEG 6000 or 8000 (Sigma, P2139), 1.47 g of CaCl2.2H2O ...
-
bioRxiv - Biochemistry 2024Quote: ... then incubated for 1-2 h at room temperature in PBST with blocking agent (5 mg/mL Bovine Serum Albumin (Sigma Aldrich) for anti-Strep blots ...
-
bioRxiv - Neuroscience 2024Quote: ... Embryos were washed 1 hour x6 and then transferred to CUBIC1 solution (25 wt% N,N,N’,N’-tetrakis(2-hydroxypropyl)ethylenediamine (Sigma 122262), 25 wt% urea and 15 wt% Triton X-100 ...
-
bioRxiv - Plant Biology 2024Quote: WT Col-0 plants were grown as described above and whole rosettes were sampled and dipped in the protein phosphatase inhibitor buffer: 1% (v/v) solution of phosphatase inhibitor cocktail 2 (Sigma: P5726) and phosphatase inhibitor cocktail 3 (Sigma ...
-
bioRxiv - Immunology 2024Quote: ... Pelleted cells were fused together by adding 1 ml of a 50% solution of PEG 4000 (EMD-Millipore Cat#9727-2) in PBS preheated at 37°C drop-wise over 1 minute ...
-
bioRxiv - Biochemistry 2024Quote: ... the two purified proteins in crystallization buffer were mixed in a 1:1.2 ratio with 2 mM AMPCPP (Millipore Sigma, M6517), incubated on ice for 10 minutes ...
-
bioRxiv - Biophysics 2024Quote: ... 50 mL of blocking buffer was prepared per 2 x 108 cells by adding 1 g of biotin-free BSA (Sigma Aldrich) and 200 mL of 0.5 M pH 8.0 EDTA into DPBS (GIBCO) ...
-
bioRxiv - Cell Biology 2024Quote: ... Human EndoC-βH3 cells (Human Cell Design) were cultured on 2 µg/mL fibronectin and 1% extracellular matrix (E1270, Sigma-Aldrich) coated plates in Advance DMEM/F-12 (Thermo Fisher Scientific) ...
-
bioRxiv - Bioengineering 2024Quote: ... The stromal cells were pelleted down by centrifugation and put back in complete low glucose DMEM with 1X antibiotic and amphotericin supplemented with 2 mM L-glutamine and 1 ng/mL basic fibroblast growth factor (bFGF) (Sigma, USA). Lastly ...
-
bioRxiv - Cancer Biology 2024Quote: ... and were treated with nocodazole (0.5 μg ml-1) and BrdU (100 μM) with or without aphidicolin (2 μM; EMD Millipore Corp). Cells were collected 36 h post-irradiation ...
-
bioRxiv - Biochemistry 2024Quote: ... Cell pellets were resuspended in 80 ml of lysis buffer (50 mM HEPES-NaOH pH 6.8, 1 mM DTT, 2 mM EDTA, protease inhibitor cocktail (Sigma-Aldrich, P8340) diluted 1:800 ...
-
bioRxiv - Cell Biology 2024Quote: ... gels were incubated in primary antibodies (Supplementary Table 4) diluted to 1:500 in antibody dilution buffer (2% bovine serum albumin (BSA; Sigma, A9647) in 1X PBS ...
-
bioRxiv - Developmental Biology 2024Quote: ... 100 µl of 1x Lysis Buffer were added (20 mM Tris-HCl pH8, 150 mM NaCl, 2 mM EDTA, 1x Protease Inhibitor Roche, #04693116001, 1% NP40 Sigma, #I8896), the embryos were smashed by pipetting up and down several times and the samples were centrifuged at 4 °C at maximum speed for 15 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... was transferred into a new microcentrifuge tube containing 40 ± 2 mg of a mixture (7:1) of anhydrous sodium sulfate (Sigma-Aldrich) and primary secondary amine (PSA ...
-
bioRxiv - Physiology 2022Quote: ... 2-bromopalmitate (2-BP) was delivered with fatty acid-free bovine serum albumin (Sigma-Aldrich, A6003) at a stock concentration 1 mM albumin with 5 mM 2-BP ...
-
bioRxiv - Immunology 2021Quote: ... Materials for interference testing included 2-phenoxyethanol (2-PE) (77699-250ML, Sigma-Aldrich, St Louis, MO), sodium citrate tribasic dihydroxide (C8532-100G ...
-
bioRxiv - Systems Biology 2021Quote: ... 2 pmol (2 µL of stock) of the non-labelled AQUA® peptide HLEAAKGYSFTTTAEKAAELHK (Sigma-Aldrich) containing the quantification tag sequence GYSFTTTAEK was added to enable quantification of SIL-protein stock concentrations using MS analysis based on the ratio of heavy-to-light GYSFTTTAEK signals (see below) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Bacterial Glycerol Stock Sequence (same as Construct 2) 2# CCGGGCTGTTACTTTCCCAGATATTCTCGAGAATATCTGGGAAAGTAACAGCTTTTTG) constructs were purchased from Sigma Aldrich. The plasmids were packaged into Lentiviral particles using the 2rd generation packaging plasmid (Addgene) ...