Labshake search
Citations for Millipore Sigma :
8801 - 8850 of 10000+ citations for 6 fluoronaphthalene 1 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2019Quote: Substrates were placed into 6-well plates and both chambers were washed three times with 50 mM HEPES pH 8.5 (Sigma H3375). The polyacrylamide was activated for ECM protein coating by covering the substrates with 500 μL of 0.5 mg/mL sulfo-SANPAH (Proteochem c1111 ...
-
bioRxiv - Plant Biology 2019Quote: ... ten first or second leaves from independent plants were harvested at the indicated time points and transferred to a 15 ml tube containing 6 ml water purified using a Milli-Q integral 5 water purification system (Millipore). After a 6 h-incubation at room temperature on a horizontal shaker ...
-
bioRxiv - Cancer Biology 2019Quote: ... 25 μl Ad5CMVFlpO (6 × 1010 PFU/ml) was incubated with 600 μl minimum essential media (Sigma-Aldrich, St Louis, MO) and 3 μl 2 M CaCl2 (Sigma-Aldrich ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... 6 µl homogenate was mixed with 94 µl Glucose Oxidase (GO) reagent from the Glucose (GO) Assay Kit (Sigma, GAGO20) containing 1 µl (0.3 U ...
-
bioRxiv - Cell Biology 2019Quote: ... The sample was then cut in half with a clean razor and each piece was placed in a 6-well plate with 10 ml of ASW and lipopolysaccharide (LPS) from Escherichia coli 0111:B4 (Sigma) at a final concentration of μg/ml (or an equal volume of sterile diH2O ...
-
bioRxiv - Molecular Biology 2019Quote: ... U2OS cells were seeded in a 6-well plate and infected with lentivirus supernatant in the presence of 5 μg/mL polybrene (Sigma). Medium was replaced by fresh media with 10 μg/mL Blasticidin S at 24 hours post-infection ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cells were washed three times with 1x PBS and incubated for 5 minutes in 300 nM 4′,6-diamidino-2-phenylindole (Sigma) before a final 1x PBS wash ...
-
bioRxiv - Cell Biology 2019Quote: Undifferentiated SGBS cells were plated at 50 % confluence in 6-well plates and infected with commercial lentiviral particles targeting either human ABCG1 (TRCN0000420907; Sigma) (TAGGAAGATGTAGGCAGATTG ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and MCA-Lys-Pro-Leu-Gly-Leu-Dpa(DNP)-Ala-Arg-NH2 (MMP substrate FS-6) was from Sigma-Aldrich. The stock solutions of the enzyme inhibitors and fluorogenic substrates were prepared according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... and resuspended in 50 to 80 µl FC buffer containing 0.1 µg/ml 4’,6-diamidino-2-phenylindole (DAPI; Sigma-Aldrich). Primary tumor samples were stained with CD45-APC-Cy7 (Biolegend ...
-
bioRxiv - Developmental Biology 2019Quote: ... Dechorionated live embryos were incubated for 6, 12 and 24 hours in 40μM Nifedipine or 20mM BDM (2, 3-butanedione-2-monoxime) (Sigma-Aldrich) in Danieau’s solution ...
-
bioRxiv - Microbiology 2020Quote: ... and the resulting adhered bacteria on the cover slip were stained with 200 μL of the membrane stain N-(3-Triethylammoniumpropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide (FM4-64) (Sigma) at a final concentration of 20 μg/mL for 5 minutes ...
-
bioRxiv - Developmental Biology 2020Quote: ... Next the slides were mounted with a coverslip using Mowiol (6 g glycerol, 2.4 gr polyvinylalcohol 4-88 (Sigma, 81381), 6 ml MQ and 12 ml 0.2 M Tris HCL pH 8.5).
-
bioRxiv - Developmental Biology 2021Quote: ... Slides were air dried for 6 hours to overnight with a post-fixation step of 15 minutes in 10% neutral buffered formalin (HT501128, Sigma) and washed in 1X PBS ...
-
bioRxiv - Developmental Biology 2021Quote: ... Slides were air dried for 6 hours to overnight with a post-fixation step of 15 minutes in 10% neutral buffered formalin (HT501128, Sigma) and washed in 1X PBS ...
-
bioRxiv - Microbiology 2021Quote: ... Labeled lentivirus particles were then purified to eliminate excess free dyes and lipids by ultracentrifugation for one hour at 40,000 rpm over a 6%-18% Optiprep (Sigma Aldrich) gradient ...
-
bioRxiv - Synthetic Biology 2020Quote: ... glass coverslips placed in 6-well plates were coated in a 0.1 mg/mL solution of poly-L-lysine hydrobromide (Sigma #P6282) for 5 min and left to dry overnight before plating 6×105 cells per well in 2 mL DMEM ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Cells were transiently transfected with plasmids in 6-well plates and 24 hours post-starvation were incubated with 100μg/ml of cycloheximide (Sigma #4859) for indicated time points ...
-
bioRxiv - Microbiology 2020Quote: ... the cells were fixed with 3% PFA/PBS and the nuclei stained with 4’,6-diamidine-2’-phenylindole (DAPI, Sigma). An inverted fluorescence microscope (Zeiss ...
-
bioRxiv - Pathology 2021Quote: ... rats in the high-dose 7-d L-DOPA priming group (n=6) were treated daily with L-DOPA (12 mg/kg) + benserazide (15 mg/kg, s.c., Sigma-Aldrich) for 7 d (i.e. ...
-
bioRxiv - Cell Biology 2019Quote: ... and plasma (n=6) of the experimental groups were filtered with a 30 kDa cut-off Microcon filter (Merck Millipore, Tullagreen Carrigtwohill Co.Cork ...
-
bioRxiv - Cancer Biology 2019Quote: ... Tissues were washed 5 times in PBT and incubated for 2h at RT with secondary antibodies and 4’,6-Diamidine-2′-phenylindole dihydrochloride (DAPI, Sigma) (1µg/mL) ...
-
bioRxiv - Developmental Biology 2020Quote: ... An incubation was done 45 min at room temperature with a mix of 4′,6-Diamidine-2′-phenylindole dihydrochloride (DAPI, 1µg/mL, 10236276001, Sigma-Aldrich) and the secondary antibody Donkey anti-Mouse Alexa Fluor 555 in PBS 1X ...
-
bioRxiv - Biophysics 2019Quote: ... as a Tobacco Etch Virus (TEV)-cleavable N-terminal His-tagged (6×-His) fusion protein using a pET46 Ek/LIC vector (Novagen) and purified using Ni-NTA affinity chromatography and gel filtration chromatography as previously described (Hughes et al ...
-
bioRxiv - Molecular Biology 2019Quote: ... was fused with an N-terminal His(6)-tag followed by maltose binding protein (MBP) tag and TEV cleavage site in pET21 vector (Novagen).
-
bioRxiv - Cancer Biology 2019Quote: ... RIPK3 inhibitor GSK 872 (N-(6-(Isopropylsulfonyl)quinolin-4-yl)benzo[d]thiazol-5-amine) was purchased from Millipore Sigma and frozen stocks were maintained in DMSO ...
-
bioRxiv - Cell Biology 2019Quote: ... then stained in 1x PBS + .5M NaCl with 50 ng/mL 4’,6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich #D9542).
-
bioRxiv - Neuroscience 2019Quote: hNSG and non-engrafted NSG mice (4-6 months old) were injected 3 mg/kg (i.p.) with lipopolysaccharide (LPS from E. coli; O55:B5, Sigma-Aldrich) or 0.9% saline solution ...
-
bioRxiv - Cell Biology 2019Quote: ... The resin was resuspended in 6 ml ice-cold G-buffer containing 5 µg/ml TLCK-treated chymotrypsin (Sigma, #C3142) and incubated overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... in 6 well plates were transfected with HSIV-vif plasmids using Fugene 6 or X-tremeGENE 9 DNA transfection reagent (Roche/Sigma). At 48 hour post-transfection ...
-
bioRxiv - Physiology 2021Quote: ... 6 × 105 cells were seeded on 6-well multiwell plates and counted every two days from day 4 to day 14 using Trypan blue (Sigma) and a Neubauer chamber.
-
bioRxiv - Immunology 2020Quote: ... Cells were washed once with PBS prior incubation for 5 min at 37 °C with 4′,6-diamidino-2-phenylindole (DAPI; Sigma). Finally ...
-
bioRxiv - Cell Biology 2022Quote: ... two shRNA targeting exon 5 and exon 6 were synthesized along with a control shRNA targeting the luciferase gene as a 97-nt ultramer (Sigma) containing 22-mer reverted repeats ...
-
bioRxiv - Developmental Biology 2021Quote: ... inactivated with 10 µg/ml mitomycin C and seeded at 4 × 105 per 6 cm dish) in DMEM/F12/KSR medium (D-MEM/F12 (Sigma) supplemented with 20% KSR additive ...
-
bioRxiv - Cell Biology 2020Quote: ... electroporated parasites were mixed immediately with 100 μl of reticulocyte-rich blood from a naïve mouse treated with phenylhydrazine (6 mg/ml) (Sigma-Aldrich), incubated at 37°C for 20 min and then injected intraperitoneally into another mouse ...
-
bioRxiv - Cell Biology 2021Quote: ... or control non-target shRNAs were induced to differentiate for 6 days and RNA was extracted with Tri-Reagent (Sigma) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... 3 µg of RNA were separated on MEN-buffered 1.5% agarose gels that provided denaturing conditions by 6% formaldehyde using an RNA sample loading buffer containing a final concentration of 62.5% (v/v) deionized formamide (Sigma-Aldrich). Afterwards ...
-
bioRxiv - Microbiology 2021Quote: ... The enzyme reaction was started by the addition of 0.16 ml of 6 mM p- nitrophenyl β-D-glucuronide (Sigma) to the broken cells and stopped by the addition of 0.4 ml of 1.0 M NaCO3 ...
-
bioRxiv - Immunology 2020Quote: ... Cells were then treated with 6-thio-dG (3-5 μM) in the presence of 500 ng/ml doxycycline (Sigma), washed three times with warm PBS and allowed to recover in regular growth medium containing 500 ng/ml doxycycline ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were then analyzed on a Guava EasyCyte 6/2L bench cytometer equipped with 488 nm and 532 nm lasers (Millipore).
-
bioRxiv - Microbiology 2020Quote: ... Cells were then fixed with 1% formaldehyde solution and analyzed using a Guava EasyCyte 6/2L bench cytometer equipped with 488 nm and 532 nm lasers (Millipore).
-
bioRxiv - Immunology 2021Quote: ... were characterized and fractionated by size exclusion chromatography using a Superose 6 10/300 GL on an AKTA liquid chromatography system and concentrated on AmiconUltra 100k spin columns (Millipore).
-
bioRxiv - Molecular Biology 2021Quote: Total splenocytes were isolated from C57BL/6 and mFICD-/- mouse spleens and then treated for 3 days with 20 μg/ml LPS (Sigma), 100 µg/ml heparan sulfate or 2.5 μM thapsigargin (Enzo Life Sciences) ...
-
bioRxiv - Immunology 2020Quote: ... Eluate from amylose resin was concentrated and purified as a range of small oligomers on a Superose 6 size exclusion column (Cytiva) in lysis buffer, concentrated again (500 μL, A280 = 6) using a 50 kDa spin column (Millipore), and cleaved overnight with MBP-3C protease (50 μL ...
-
bioRxiv - Cell Biology 2020Quote: ... were seeded at 200,000 cells/well of 6 well plates and transduced with lentiviral particles at final MOI of 0.5 with 8 µg/ml polybrene (Sigma-Aldrich). Transduced cells were selected in 10 µg/ml puromycin (Gibco ...
-
bioRxiv - Immunology 2021Quote: ... or 0.5 μM/ml 5-amino-6-D-ribitylaminouracil (5-A-RU) (courtesy of Jeffrey Aubé, UNC) and 50 μM/ml Methylglyoxal (Sigma). Brefeldin A Solution (Biolegend ...
-
bioRxiv - Neuroscience 2021Quote: ... a pool of 4 brains was used (n = 6) and mixed with 600 μL of phosphate-buffered saline (PBS, pH 7.4, Sigma-Aldrich). The homogenate was centrifuged at 2400 g for 10 min at 4 °C and the supernatants were collected for the analyses of the following parameters ...
-
bioRxiv - Microbiology 2022Quote: ... then resuspended in complete DMEM for analysis by flow cytometry on a Guava EasyCyte 6/2L bench cytometer equipped with 488nm and 532nm lasers (Millipore). Control wells were prepared without sporozoites to measure the basal level of dextran uptake ...
-
The intestinal circadian clock drives microbial rhythmicity to maintain gastrointestinal homeostasisbioRxiv - Physiology 2022Quote: Complete GI transit time (GITT) was measured by administering natural carmine red (6%, SigmaAldrich) dissolved in 0.5% methylcellulose (Sigma-Aldrich) by gavage (100ul ...
-
bioRxiv - Cancer Biology 2022Quote: ... see Figure S1A and 22) added to the cells with 400 µg/ml of poloxamer-407 (Sigma, 9003-11-6) and incubated in a 37°C CO2 incubator for another 24 hours (Figure 1A) ...