Labshake search
Citations for Millipore Sigma :
801 - 850 of 2392 citations for bta mir 486 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... at RT for 60 min and alkylated with 40 mM iodoacetamide (Sigma-Aldrich) at RT in the dark for 60 min ...
-
bioRxiv - Microbiology 2021Quote: ... blocked for 30 min at RT with 10% heat-inactivated goat serum (Sigma) in PBS−/− ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were blocked for 1 hour at RT in a phosphoprotein blocker (Millipore) and probed for total (Cell Signaling ...
-
bioRxiv - Immunology 2020Quote: ... for 1 h at RT in microscopy buffer (5% w/V BSA (Sigma), 0,06% w/V saponin (Sigma ...
-
bioRxiv - Plant Biology 2019Quote: Reverse transcription (RT) was performed on total RNA extracted using Tri-Reagent (Sigma) from untreated and UV-C treated plants (time points 0 ...
-
bioRxiv - Cell Biology 2021Quote: ... and permeabilised for 20min at RT using PBS/0.25% Triton X-100 (Sigma). Cells were blocked for 30min at RT with blocking solution (PBS-0.25% Triton X-100 plus BSA 1%) ...
-
bioRxiv - Neuroscience 2022Quote: ... blocked for 1 hour at room temperature (RT) with 6% donkey serum (Sigma) + 0.3% Triton X-100 (Sigma ...
-
bioRxiv - Molecular Biology 2022Quote: ... 50 % glycerol for GII RTs) with an Amicon Ultra-15 (30k) concentrator (Millipore) according to the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2022Quote: ... PBS pH 7.2) at RT for 1h and incubated with Acta2 antibody (Sigma) at 40C overnight ...
-
bioRxiv - Neuroscience 2022Quote: ... blocked for 1 hour at room temperature (RT) with 6% donkey serum (Sigma) + 0.3% Triton X-100 (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... 24h later at least 1h at RT and stained with crystal violet (Sigma). PFU were counted from each dilution in order to determine the infectious titer (in PFU/mL ...
-
bioRxiv - Pathology 2023Quote: ... washed and fixed 8 h (RT) in 4% paraformaldehyde (P6148, Sigma Aldrich, USA). Tissues were embedded in Tissue-Tek OCT Compound (Sakura Finetek ...
-
bioRxiv - Pathology 2023Quote: ... for 60 min at RT and visualized using 3,3-diaminobenzidine (DAB) (Sigma, 11718096001) for 10 min at RT ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The tissues were stained overnight at RT using DAPI (1 µg/µl) (Sigma) diluted at 1× PBS.
-
bioRxiv - Bioengineering 2024Quote: ... and fixation initiated at RT in 10% neutral buffered formalin (NBF, Sigma-Aldrich), followed by fixation/storage at 4°C ...
-
bioRxiv - Developmental Biology 2019Quote: ... PCR-based (Sigma-Aldrich).
-
bioRxiv - Cell Biology 2020Quote: ... SYBR green primers were designed in house and bought from Sigma-Aldrich (Gillingham, UK) corresponding to ...
-
bioRxiv - Genomics 2019Quote: ... with primers 5’ GAGCTGGACGGCGACGTAAACG 3’ and 5’ CGCTTCTCGTTGGGGTCTTTGCT 3’ for amplification (Sigma-Aldrich, Germany). The PCR amplification was as follows ...
-
bioRxiv - Cancer Biology 2019Quote: ... Each sample was amplified in triplicate using custom-designed primers (Sigma, Supplementary Table 2) in a HT7900 Real Time PCR System using SensiMix SYBR-Green Mix (Bioline ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was quantified by using predesigned KiCqStart SYBR® Green primers (# KSPQ12012, Sigma Aldrich, sequences of the primers provided in supplementary table-1, ...
-
bioRxiv - Biochemistry 2020Quote: ... Primers used in this study were synthesized by Sigma-Aldrich (St. Louis, Missouri, US) and all constructs were verified by sequencing at Microsynth Seqlab GmbH (Göttingen ...
-
bioRxiv - Bioengineering 2021Quote: ... was used with CyHV-3 specific primers and probes (Sigma-Aldrich, St. Louis, USA). Further information is given in the Supporting Material (Table S3) ...
-
bioRxiv - Cell Biology 2020Quote: ... Amplification of cDNA (22 amplification cycles) was performed using 0.55 μM ISPCR primers (Sigma) and 1 x KAPA HiFi Hotstart mix (Roche) ...
-
bioRxiv - Cell Biology 2022Quote: ... Primers for each gene of interest were ordered from Sigma-Aldrich (Supplementary Table 2), and a separate master mix was prepared for each primer set using the TB Green® Premix Ex Taq II (TLi RNaseH Plus ...
-
bioRxiv - Microbiology 2022Quote: Modifications were revealed by elongating fluorescent primers (WellRed D2 or D4 fluorophore from Sigma, for sequences ...
-
bioRxiv - Genetics 2022Quote: ... according to the manufacturer’s instructions using primers: AGGCCGTGAGTTCTCATTGG (fwd) and GGGTTTCAGGGAGCTGAGAC (rvs) (Sigma-Aldrich). Expected amplification was confirmed using gel electrophoresis ...
-
bioRxiv - Microbiology 2021Quote: ... Oligonucleotide primers used in these studies were purchased from Sigma-Aldrich (St. Louis, MO); primer sequences are provided in S6 Table.
-
bioRxiv - Microbiology 2020Quote: ... by using specific primers (supplementary Table II) according to the manufacturer instructions (Sigma-Aldrich).
-
bioRxiv - Cell Biology 2020Quote: ... Predesigned KiCqstart qPCR primers for ARFGAP1 (H_ARFGAP1_1) and TMED9 (H_TMED9_1) were purchased from Sigma.
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... The absence of primer secondary structure was analyzed using OligoEvaluator (Sigma-Aldrich, http://www.oligoevaluator.com/).
-
bioRxiv - Neuroscience 2020Quote: ... cathepsins B L and S commercial primers were purchased from Sigma-Aldrich (Table 1). Their specificity was assessed using melting curves and electrophoresis in 2% agarose gels ...
-
bioRxiv - Molecular Biology 2021Quote: ... Forward and reverse primers (oligos) consistent for each sgRNA were purchased (Merck, Sigma-Aldrich) including sticky ends corresponding to the cleavage pattern of the restriction enzyme BsmBI according to the protocol of Kwart et al ...
-
bioRxiv - Molecular Biology 2022Quote: ... was added to serve as primer for cDNA synthesis along with DEPC (Sigma-Aldrich) treated double autoclaved MilliQ water ...
-
bioRxiv - Cell Biology 2023Quote: ... Peroxisome and trafficking pathway gene primers were designed by NCBI and purchased from Sigma. The housekeeping gene GAPDH was used as normalizing control to calculate the fold change.
-
bioRxiv - Pathology 2024Quote: Genotyping was performed as previously described 19 using the following primers (Sigma Aldrich; USA) for VHL floxed alleles ...
-
bioRxiv - Biochemistry 2024Quote: ... Binding pocket mutants were generated by site-directed mutagenesis using primers from Millipore sigma and sequenced (Elim Biopharmaceuticals ...
-
bioRxiv - Molecular Biology 2021Quote: Hamster and mouse tissues were homogenized mechanically in RIPA lysis buffer supplemented with 1x protease inhibitor cocktail set (Millipore) and loaded with SDS dye ...
-
bioRxiv - Cell Biology 2019Quote: ... All animals were mounted on 10% agarose pads set on microscope slides and immobilized using 10 mM tetramisole (Sigma). Unless noted otherwise ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were then labelled with different sets of primary and secondary antibodies: mouse anti-HA antibody (1:1000, Sigma), mouse anti-FLAG (1:1000) ...
-
bioRxiv - Microbiology 2021Quote: ... The protocol was set up as isocratic separation using a mobile phase containing 0.1 M ammonium dihydrogen phosphate (NH4H2PO4, Sigma), pH 6.0 ...
-
bioRxiv - Molecular Biology 2021Quote: Boyden chamber transwell migration assays were set-up according to the cell migration assay kit manufacturer’s instructions (Sigma #ECM507), with RAW264.7 macrophages seeded in the upper chamber (30,000 per chamber ...
-
bioRxiv - Biochemistry 2020Quote: ... A 96-well dot blot apparatus (Schleicher & Schuell) was set up with a 0.45-μm-pore-size polyvinylidene difluoride (PVDF) membrane (Immobilon-P; Millipore), and each dot was rinsed with 500 μl of TBS ...
-
bioRxiv - Synthetic Biology 2021Quote: ... this set-up was connected to a 250 µL glass syringe (SGE Gas Tight Syringe, luer lock, Sigma-Aldrich) using a shortened needle as connector (Hamilton Needle ...
-
bioRxiv - Biophysics 2021Quote: ... A set of sequence ladders for the MS2 coat protein was obtained by addition of the four ddNTPs (Sigma) in a final concentration of 1 mM each to the M-MulV reaction mix containing dNTPs at 0.25 mM each ...
-
bioRxiv - Developmental Biology 2019Quote: ... nearly all supernatant was removed and tissue was incubated in 1 ml of cold hypotonic PBS solution (10mM Na2HPO4, 1.8mM KH2PO4, 10mM KCl, 0.2mM MgCl2) plus 1:100 protease inhibitor cocktail set III (Millipore Sigma) for 10 minutes on ice to lyse cells ...
-
bioRxiv - Genomics 2021Quote: We extend our TWO-SIGMA method [38] to competitive gene set testing via TWO-SIGMA-Geneset (TWO-SIGMA-G), on overview of which is shown in Figure 1 ...
-
bioRxiv - Immunology 2020Quote: ... DNA was removed from total RNA preparations using On-Column DNase I Digestion Set (Sigma Aldrich, St. Louis, MO). cDNA was synthesized from 1 μg of total RNA using Super Script III First Strand cDNA Synthesis Kit (Invitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: ... Where a duplicate set of cells of each group was pretreated with paclitaxel (50nM in DMSO; Sigma Aldrich,A) for two hours prior to each irradiating step (Rad x1 ...
-
bioRxiv - Neuroscience 2023Quote: ... TUNEL staining was performed in a set of sections using the ApopTag in situ apoptosis detection kit (S7165, Millipore). Sections were visualized under confocal microscopy (Nikon) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... PCR products were purified using GenElute™ PCR Clean-Up Kit (Sigma-Aldrich), after restriction digestion of the PCR mixture with DpnI (Thermo Fisher Scientific ...