Labshake search
Citations for Millipore Sigma :
8101 - 8150 of 10000+ citations for Recombinant Human MSLN Protein Fc tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: The mouse was induced by injecting 2 month-old female BALB/c mice with2 mg human-derived proteoglycan (PG) together with 2 mg DDA (Sigma, MO, united States). as described previously (1) ...
-
A Universal Proximity CRISPR Cas12a Assay for Ultrasensitive Detection of Nucleic Acids and ProteinsbioRxiv - Synthetic Biology 2019Quote: ... Human serum, magnesium chloride hexahydrate (MgCl2⋅6H2O), and 100×Tris−EDTA (TE, pH 7.4) buffer were purchased from Sigma-Aldrich (Mississauga, ON, Canada). NANOpure H2O (> 18.0 MΩ) ...
-
bioRxiv - Systems Biology 2019Quote: ... The assay named ‘Other Luminex’ was performed only for study SLVP015 in 2007 using the Human 42-Plex Polystyrene Kit (EMD Millipore, H42; MPXHCYTO060KPMX42) and data was processed in the same way as for the Luminex assays described above (measurement units reported were Zlog2)28.
-
bioRxiv - Cancer Biology 2020Quote: Whole cell lysates from different groups were collected and incubated with magnetic bead RIP buffer containing anti-human argonaute 2 (Ago2) antibody (Millipore, Billerica, MA, USA) and anti-human CPEB2 antibody (Proteintech ...
-
bioRxiv - Microbiology 2020Quote: Levels of cytokines/chemokines in macaque plasma were measured using the Milliplex MAP non-human primate cytokine panel and Luminex 200 (Millipore Corp., Billerica, MA) following the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Human lung fibroblast cells MRC-5 (ATCC® CCL-171) were propagated in Dulbecco’s Modified Eagle Medium (DMEM; Sigma, St. Louis, MO, USA) supplemented with 1% (v/v ...
-
bioRxiv - Microbiology 2020Quote: ... and rested overnight at 37°C/5%CO2 in RPMI-1640 medium supplemented with 10% heat-inactivated human AB serum (Sigma Aldrich, Missouri, USA), 2 mM L-glutamine and 1 mM sodium pyruvate before infection ...
-
bioRxiv - Immunology 2020Quote: ... monoclonal antibodies were produced by transient co-transfection of 293-F cells with human heavy chain and light chain antibody expression plasmids using polyethylenimine (PEI) (Sigma-Aldrich, catalog #408727). Seven days after transfection ...
-
bioRxiv - Cell Biology 2021Quote: Binding of RBD to the surface of cells was measured by flow cytometry after incubation with increasing doses of human lactoferrin (0, 1, 5 and 10 mM) (Sigma Aldrich Cat#: L1294) in a final volume of 100 μL of culture medium ...
-
bioRxiv - Neuroscience 2020Quote: ... untagged human α-synuclein (100 μg/well) —purified as previously described [17]—and 10 μM ThT in dPBS (Sigma-Aldrich, St. Louis, MO) were combined in a final volume of 95 μl of dPBS ...
-
bioRxiv - Molecular Biology 2020Quote: Lentiviral pLKO.1-puro empty vector control plasmid and human TENT4A shRNA pLKO.1-puro plasmid (clone TRCN0000053036, target sequence CCAACAATCAGACCAGGTTTA) were obtained from Sigma (Mission shRNA library). Lentiviruses were produced in 293FT cells ...
-
bioRxiv - Immunology 2020Quote: Cytokine were measured in cell-free PBMC supernatant using MILLIPLEX-MAP human cytokine/chemokine magnetic bead panel (EMD Millipore Corporation, Billerica, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... The pyrosequencing assay was validated using SssI-treated human genomic DNA as a 100% methylation control and human genomic DNA amplified by GenomePlex Complete Whole Genome Amplification kit (Sigma-Aldrich, WGA2-50RXN) as 0% methylation control ...
-
bioRxiv - Immunology 2022Quote: Cells were isolated from human blood using density gradient centrifugation agent Ficoll®-Paque Premium (17-5442-02, GE Healthcare, SIGMA, Darmstadt, Germany). Monocytes were plated at 3×105 cells per well in plastic 24 well plates ...
-
bioRxiv - Cell Biology 2022Quote: ... The mouse mAb MEM48 which recognizes the human β2 integrin subunit (catalog #CBL158) and the mouse mAb 1965 against the human β1 integrin subunit (catalog #MAB1965) were from EMD Millipore (Burlington, MA). The rat PE-conjugated mAb against F4/80 (catalog #12-4801-82 ...
-
bioRxiv - Biochemistry 2024Quote: ... Electroporated cells were cultured in erythroid differentiation medium (EDM) consisting of IMDM (GibcoTM, 12440061) supplemented with 330 µg/ml of Holo-Human Transferrin (Sigma-Aldrich, T0665-1G), 10 µg/ml of recombinant human insulin (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... was added to the cell pellet and stored at −20°C prior to being assayed for insulin using human insulin specific RIA (Millipore Cat# HI-14K).
-
bioRxiv - Immunology 2024Quote: ... Two different Mission lentivirus-based plasmids of shRNAs (clone numbers TRCN0000123050 and TRCN0000436778) against human ZBP1 and the shcontrol vector TRC2 pLKO.5-puro nonmammalian shRNA (SHC202) were obtained from Sigma-Aldrich (Burlington, MA). 293T cells were cotransfected with the shRNA and packaging plasmids psPAX2 and pMD2 using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... and HOS-ACE2/TMPRSS2 cells (HOS cells stably expressing human ACE2 and TMPRSS2)36,37 were maintained in DMEM (high glucose) (Sigma-Aldrich, Cat# 6429-500ML) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2022Quote: ... and HOS-ACE2/TMPRSS2 cells (HOS cells stably expressing human ACE2 and TMPRSS2)32,33 were maintained in DMEM (high glucose) (Sigma-Aldrich, Cat# 6429-500ML) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2023Quote: ... human islets were dispersed using dissociation solution (1X TrypLE™ Express solution - Thermo Fisher Scientific, with 40 µg/mL DNase I - Sigma-Aldrich) through gentle pipetting for 10 minutes at 37°C ...
-
Microhomology-Mediated Circular DNA Formation from Oligonucleosomal Fragments During SpermatogenesisbioRxiv - Genomics 2023Quote: ... The cauda epididymis was quickly cut into pieces and incubated in 1 ml pre-warmed human tubal fluid (HTF) (Millipore, MR-070-D) for 15 min at 37°C ...
-
bioRxiv - Immunology 2023Quote: ... diluted in FACS-blocking buffer (mixture of 0.66% human/rabbit/mouse serum, Sigma-Aldrich, and 1% Bovine Serum Albumin, Sigma-Aldrich in PBS) for 30 minutes at 4°C ...
-
bioRxiv - Genetics 2023Quote: ... The lentivirus enriched-medium was immediately used to transduce the human fibroblasts growing on a T25 flask in the presence of 8µg/ml polybrene (Sigma-Aldrich, San Luis, MO). Infected fibroblasts were maintained in culture until having enough cells for cell sorting ...
-
bioRxiv - Neuroscience 2023Quote: ... and immediately incubated at 4°C in the primary antibody against the N-terminus of human Fos (overnight, 1:2000; Rabbit polyclonal, ABE457, Millipore; RRID: AB_2631318 (56) (Exp ...
-
bioRxiv - Immunology 2023Quote: Concentrations of cytokines in supernatants of T cell cultures were assessed with the MILLIPLEX MAP Human Th17 magnetic bead panel kit (Merck Millipore, Burlington, MA, USA) and the Luminex® 200™ system according to the guidelines of the manufacturer ...
-
bioRxiv - Immunology 2023Quote: ... ELISA signal in each elution sample was checked using 1:5000 diluted goat anti-human IgG (Fab specific) HRP-conjugated secondary antibodies (Sigma-Aldrich, A0293-1ML). Elution fractions showing an ELISA signal were pooled and concentrated under vacuum to a volume of ∼1 μL ...
-
bioRxiv - Molecular Biology 2023Quote: ... and a subsequent 6-day differentiation step in serum-free medium containing 50 ng/ml human brain derived neurotrophic factor (BDNF) (Sigma-Aldrich, Cat# B3795). Cells were seeded at an initial density of 2 × 104 cells/cm2 in 24-well plate coated with Type I collagen (Corning ...
-
bioRxiv - Cancer Biology 2023Quote: Mouse (5 x 105 cells) and human (2 x 105 cells) keratinocytes were seeded onto 12 mm diameter inserts (Millipore, Catalog No. PIHP01250) and cultured in CnT-Prime medium ...
-
bioRxiv - Developmental Biology 2023Quote: ... The cell lysate was generated as a Western blot positive control from the human endometrial epithelium Ishikawa cell line (Sigma-Aldrich, Madrid, Spain), as in a previous study (Vilella et al. ...
-
bioRxiv - Bioengineering 2024Quote: IDUA enzyme expression was measured fluorometrically in a 96-well plate using a Human IDUA ELISA kit (Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturer’s sandwich assay protocol ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The CAR T cell product was cultivated in RPMI+10%FBS+1%PS at 37°C with 5% CO2 for experiments and cryopreserved as 10×106 cells/mL in 1 mL 90% heat-inactivated Human AB Serum (Sigma-Aldrich, Cat.#H4522) +10% DMSO in liquid nitrogen ...
-
bioRxiv - Immunology 2024Quote: ... Total transferrin was kept constant at 1.2 mg/mL by adjusting human apotransferrin (unbound transferrin) concentrations (R&D systems, 3188-AT-001G/Sigma Aldrich, T1147) accordingly ...
-
bioRxiv - Neuroscience 2024Quote: ... Both mouse and human brain sections were labeled for TH (mouse monoclonal, clone LNC1, 1:2000, Catalog No. MAB318, EMD Millipore, Burlington, MA) and VGLUT2 (rabbit polyclonal ...
-
bioRxiv - Bioengineering 2024Quote: ... human chorionic gonadotropin (hCG, for Jurkat: high 1000 IU/mL and low 200 IU/mL; PBMC: 500 IU/mL, Sigma catalog #CG5-1VL). Media controls were used to determine if media components alone affect protein secretion and expression ...
-
bioRxiv - Biophysics 2021Quote: ... the diluted protein solution was carefully mixed with Ficoll-70 (Sigma-Aldrich, Cat# 72146-89-5) or BSA (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2021Quote: ... The purified protein sample was concentrated in 100 kDa molecular weight cut-off (MWCO) concentrator (Millipore) to 3 mg/ml by centrifugation at 2,500 g.
-
bioRxiv - Cancer Biology 2021Quote: ... Separated protein was transferred onto a Immobilon-FL PVDF membrane (Millipore Sigma, Burlington, MA, USA #IPFL00010). Membranes were blocked in 5% milk in TBS with 0.1% Tween-20 (TBS-Tween ...
-
bioRxiv - Cancer Biology 2021Quote: ... Protein samples were resolved on 8–12% SDS–polyacrylamide gels and transferred to nitrocellulose membranes (Millipore). Subsequently ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA-protein complexes were immunoprecipitated with 12 μg anti-FLAG M2 antibody (Sigma-Aldrich, Cat #F1804) or 8 μg anti-U2AF2 antibody (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2019Quote: ... 30 μg of protein were subsequently labelled with stable-isotope labelled iodoacetamide (heavy IAA, 13C2D2H2INO, Sigma) to alkylate reversibly oxidised cysteines ...
-
bioRxiv - Cell Biology 2020Quote: ... Bacteria were harvested by centrifugation and resuspended in BugBuster® Protein Extraction Reagent (Millipore #70584-4) supplemented with protease inhibitor cocktail (cOmplete EDTA-free ...
-
bioRxiv - Cell Biology 2020Quote: Total protein cell lysates were obtained using RIPA buffer containing protease inhibitor cocktail (11697498001, Sigma-Aldrich), phosphates inhibitors (A32957 ...
-
bioRxiv - Cell Biology 2020Quote: ... The translated protein was immunoprecipitated using 1.2 mg of anti-Flag coupled magnetic beads (Sigma-Aldrich, #F1804 ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 dpf larvae with sparse fluorescent protein labeling of PNs were anaesthetized in 0.001% MS222 (Sigma) for 1 minute ...
-
bioRxiv - Developmental Biology 2021Quote: ... Proteins were separated by SDS-PAGE under reducing conditions and then transferred onto PVDF membranes (Millipore) for Western blot analysis.
-
bioRxiv - Immunology 2021Quote: ... host mice were challenged with 7.5 μg of full-length OVA protein (grade V, Sigma Aldrich) injected into the caudal tail vein ...
-
bioRxiv - Molecular Biology 2021Quote: ... except that elution of bound proteins was done using 100 μg/ml FLAG peptide (Sigma, F3290).44 In brief ...
-
bioRxiv - Immunology 2020Quote: Equal amounts of protein extracts were separated by SDS-PAGE and transferred to PVDF membrane (Millipore). Bands were detected with enhanced chemiluminescence (ECL ...
-
bioRxiv - Molecular Biology 2021Quote: ... Proteins samples were then transferred from the acrylamide gel onto a methanol activated PVDF membrane (Millipore) for 1 hour at 100 V ...