Labshake search
Citations for Millipore Sigma :
751 - 800 of 2891 citations for ssc mir 17 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... followed by 3X washes with 2XSSC and 30 min incubation in 2X SSC + 0.1% Tween20 (2XSSCT) + 50% (v/v) formamide (EMD Millipore, cat#S4117). For each sample ...
-
bioRxiv - Bioengineering 2021Quote: ... for 12 days in SSC expansion media with the following additions: 100 ng/mL follicle stimulating hormone from human pituitary (FSH, Millipore Sigma, F4021), 10 ng/mL luteinizing hormone from human pituitary (LH ...
-
bioRxiv - Bioengineering 2022Quote: ... we first mixed together all the secondary probes with 10% hybridization buffer with Triton-X (10% formamide, 10% dextran sulfate, 2X SSC, and 0.1% Triton-X (Sigma-Aldrich, T8787-100ML)) to a final ~20nM concentration per probe (range ...
-
bioRxiv - Physiology 2022Quote: ... Dead cells and doublets were excluded on the basis of FSC and SSC distribution and DAPI exclusion (Sigma-Aldrich, catalogue number D9542) exclusion ...
-
bioRxiv - Cancer Biology 2020Quote: ... followed by 3X washes with 2XSSC and 30 min incubation in 2X SSC + 0.1% Tween20 (2XSSCT) + 50% (v/v) formamide (EMD Millipore, cat#S4117). For each sample ...
-
bioRxiv - Genomics 2022Quote: Samples were then co-stained with 5ng/ml DAPI for 15 mins and imaged in an anti-bleaching buffer (50mM Tris-HCl, pH=8.0, 300mM NaCl, 2×SSC, 3mM Trolox (Sigma-Aldrich, Cat. 238813), 0.8% D-glucose (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5x SSCT buffer was prepared by diluting 20x SSC (saline sodium citrate) in DEPC water and adding 0.1% tween (Sigma Aldrich, Cat# P1379). Next ...
-
bioRxiv - Biophysics 2023Quote: ... cells in each well were incubated with 100 µL of hybridization buffer (2× SSC, 50% formamide and 10% w/v dextran sulfate (Sigma, D8906-50G) mixed with ∼1 µM total primary probes ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by 3X washes with 2XSSC and 30 min incubation in 2X SSC + 0.1% Tween20 (2XSSCT) + 50% (v/v) formamide (EMD Millipore, cat#S4117). For each sample ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were deproteinated for 15 minutes in 0.1 N HCl and neutralized for 5 minutes in 2X Saline Sodium Citrate buffer (2X SSC) (Sigma Aldrich, Cat # S6639) at room temperature ...
-
bioRxiv - Cancer Biology 2021Quote: RIP assay was performed using the Magna RIP RNA IP kit (17–700) from Millipore according to manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... The following antibodies were used (4 μg/sample): H3K27me3 (Upstate/Millipore, cat. no. 17-622), EZH2 (Upstate/Millipore ...
-
The pan-cancer lncRNA PLANE regulates an alternative splicing program to promote cancer pathogenesisbioRxiv - Cancer Biology 2020Quote: RIP assays were performed using a Magna RIP™ Kit (Millipore, #17-700; Darmstadt, Germany) according to the instruction provided by the manufacturer ...
-
bioRxiv - Microbiology 2020Quote: ... Huh7 and WCH-17 cells were maintained in DMEM (Wako) containing 10% FBS (Sigma Aldrich), 100 unit/ml penicillin (Meiji) ...
-
bioRxiv - Biochemistry 2019Quote: ... To the second aliquot (100 µl) was added an internal standard (FA 17:0, Sigma + 0.001% of BHT ...
-
bioRxiv - Biochemistry 2019Quote: ChIP was performed using the EZ-ChIP™ A - Chromatin Immunoprecipitation Kit (Millipore, 17-371) according to manufacturer’s instruction ...
-
bioRxiv - Genetics 2020Quote: ChIP was performed using the EZ-ChIP™ Chromatin Immunoprecipitation Kit (Cat# 17-371, Millipore) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Kolliphor EL and 0.9% (w/v) NaCl (2:1:17; all Sigma-Aldrich, Poole, UK) was administered twice daily over five days via intraperitoneal (i.p. ...
-
bioRxiv - Molecular Biology 2022Quote: ChIP assays were performed using a ChIP assay kit (Millipore EZ-CHIP 17-371, USA) according to the manufacturer’s instructions38 ...
-
bioRxiv - Neuroscience 2022Quote: ... GBR-12909 dihydrochloride (17 mg/kg at 5 mg/ml; Sigma Aldrich, St. Louis, MO), and a D2 dopamine receptor (D2R ...
-
bioRxiv - Immunology 2023Quote: ... Beads were washed 6 times with ice-cold RIP wash buffer (Millipore, cat#17-700). RNA was extracted using RNAzol (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... Leukocytes were enriched by centrifugation with 40% Percoll plus (Millipore Sigma, Cytiva 17-5445-02). Blood samples were collected from the heart with a 1-mL syringe ...
-
bioRxiv - Neuroscience 2023Quote: ... or LentiBrite RFP Control Lentiviral Biosensor (Millipore, #17-10409, titer 4.59 x 108 IFU/mL) at MOI of 20 for 24 hours ...
-
bioRxiv - Cancer Biology 2023Quote: ... and brain samples were subjected to 33-40% Percoll gradient (Sigma-Aldrich #17-0891-01) to remove myelin then resuspended in red blood cell (RBC ...
-
ALS iPSC-derived microglia and motor neurons respond to astrocyte-targeted IL-10 and CCL2 modulationbioRxiv - Neuroscience 2023Quote: ... or LentiBrite RFP Control Lentiviral Biosensor (Millipore, #17-10409, titer 4.59 x 108 IFU/mL) at MOI of 20 for 24 hours ...
-
bioRxiv - Genomics 2023Quote: ... peripheral blood mononuclear cells (PBMCs) were isolated using 63% Percoll (Sigma, Cytiva;17-0891-01) solution ...
-
bioRxiv - Genetics 2024Quote: ... The precleared chromatin sample was incubated with 0.5 μg of anti-H3K4me3 (Millipore 17-614) or 1 μg anti-nucleosome (58 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... at 10 nM or for two days with 17-ß estradiol (E2) (Sigma Aldrich, E8875) at the same concentration following by two days with progesterone (P4 ...
-
bioRxiv - Immunology 2024Quote: PP2A enzymatic activity was assessed using the PP2A Immunoprecipitation Phosphatase Assay Kit (17-313; Millipore) per the manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... The precleared chromatin sample was incubated with 0.5 μg of anti-H3K4me3 (Millipore 17-614) or 0.75 μg anti-H3K36me3 (Cell Signaling #4909 ...
-
bioRxiv - Cell Biology 2022Quote: ... for 1h at RT, blocked for 1h at RT in blocking solution (0.3% Triton X-100, 0.2% BSA (A4503, Sigma), and 5% goat serum (005-000-121 ...
-
bioRxiv - Immunology 2022Quote: ... and fixed in RT methanol (Sigma-Aldrich) for 2 minutes prior to PAS staining according to manufacturer’s protocol (Sigma-Aldrich ...
-
bioRxiv - Genomics 2019Quote: ... reverse transcribed with AMV RT (Sigma 10109118001), and then cDNA were quantified in multiplex TaqMan qPCR reactions using commercially available probe sets (Thermo Fisher 4453320 ...
-
bioRxiv - Molecular Biology 2023Quote: ... supplemented with 1U ThermaStop-RT (Sigma-Aldrich) per 50U SSIII to increases RT-PCR specificity ...
-
bioRxiv - Molecular Biology 2020Quote: ... for NdeI (forward primer) and NotI (reverse primer) were included so that the entire ORF could be directly cloned into the pET23a (Novagen) vector ...
-
bioRxiv - Microbiology 2021Quote: ... Lak candidate primers with amplicons 114-221 bp were designed in Primer-BLAST51 and synthesised by Sigma-Aldrich (MO, USA), along with Prevotella primers ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2 μL 1 μM primer (equal mix of Forward and Reverse primers; Table S2) and 5 μL 2x SYBR Green master mix (Sigma) in a 384-well plate using a Roche LightCycler 480 with the following parameters ...
-
bioRxiv - Cell Biology 2023Quote: ... for 30 minutes at RT and permeabilized for 15 minutes at RT with 0.2% Triton 100 X buffer (Sigma). Calu-3 cells were fixed with 4% PFA for 20 minutes at RT and permeabilized for 15 minutes at RT with 0.2% Triton 100X buffer ...
-
bioRxiv - Microbiology 2020Quote: ... The primers were obtained from Sigma-Aldrich (UK).
-
bioRxiv - Cell Biology 2020Quote: ... E@sy Oligo primers (Millipore-Sigma, Burlington, MA) or TaqMan Assays (Life Technology ...
-
bioRxiv - Microbiology 2019Quote: ... The forward and reverse primers (Sigma-Aldrich®) were 5’GAAGATGTCAACCTAGGGAGC3’ and 5’TGGCGAATTCTTCTTTAAGC3’ respectively ...
-
bioRxiv - Neuroscience 2021Quote: ... All other primers were obtained from Sigma-Aldrich. The reference gene used was b-actin ...
-
bioRxiv - Molecular Biology 2020Quote: ... The primers used (by Sigma-Aldrich, ON, Canada) for amplification are shown in S1 Table ...
-
bioRxiv - Cell Biology 2021Quote: ... Gene-specific primers were obtained from Sigma Aldrich. Either Hgprt or Gapdh was used as the normalizing control and quantification was done by the comparative Ct method.
-
bioRxiv - Biophysics 2020Quote: ... Primers were synthetized by Sigma-Aldrich (Table 1).
-
bioRxiv - Biochemistry 2020Quote: ... primers and oligonucleotides were purchased from Sigma Aldrich. Poly clonal and monoclonal antibodies against topo I were generated in the laboratory ...
-
bioRxiv - Neuroscience 2021Quote: ... Forward and reverse primers were ordered from Sigma and used at a concentration of 100 nM each ...
-
bioRxiv - Microbiology 2019Quote: ... The primer sequences were synthesized by Sigma-Aldrich, and the sequences are gParacoccin forward (5’-GGCGCGCCATGGCCTTCGAAAATCAG-3’ ...
-
bioRxiv - Physiology 2021Quote: ... All primers were obtained from Sigma (Table 1). All experiments were performed in three technical replicates ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... 0.3 μM of each primer (Sigma-Aldrich Inc.), 1.5U Taq polymerase (New England BioLabs® Inc. ...