Labshake search
Citations for Millipore Sigma :
601 - 650 of 10000+ citations for 6 Methyl benzo 1 3 dioxole 5 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2019Quote: Rapamycin (LC-Laboratories, R-5000) and benomyl (methyl 1-[butylcarbamoyl]-2-benzimidazolecarbamate; Sigma Aldrich, PCode 1002355429) were dissolved in DMSO at a concentration of 1 mM and 30 mg/ml ...
-
bioRxiv - Cancer Biology 2023Quote: ... We next added 30 μL N–methyl–N–(tert–butyldimethylsilyl)trifluoroacetamide + 1% tert–Butyldimethylchlorosilane (Sigma 375934) and incubated homogenized samples at 80 °C for 2 hr ...
-
bioRxiv - Biophysics 2024Quote: ... 10 mM MgCl2) for treatment with the modifier 1-methyl-7-nitroisatoic anhydride (1M740; Sigma- Aldrich). 1.72 μL of 1M7 (100 μM stock ...
-
bioRxiv - Bioengineering 2021Quote: ... The secondary antibodies were washed away with PBS (3x 5 min) whereafter 4’,6-diamidino-2-phenylindole (DAPI, 1:500, Sigma) was added for 10 minutes to localize the cell nuclei ...
-
bioRxiv - Neuroscience 2021Quote: ... nuclear labelling was achieved by incubating the sections for 5 min in DAPI (4′,6-diamidino-2-phenylindole; 1:5000; Sigma). Two final washes in PBS were performed before the sections were mounted on glass slides using Vectashield (Vector Laboratories ...
-
bioRxiv - Molecular Biology 2019Quote: ... cells were washed three times in PBS and mounted in 70% glycerol with with 5 μgml-1 concentration of 4-6-diamidino-2-phenylindole (DAPI, Sigma) and cells were mounted on cover slips ...
-
bioRxiv - Developmental Biology 2020Quote: ... The pregnant mice were serially scanned at E6.5 either after intra-peritoneal administration of 1µg/g BW of hyaluronan synthesis inhibitor 6-diazo-5-oxo-1-norleucine (DON, Sigma-Aldrich) at E3.5-E5.5 ...
-
bioRxiv - Immunology 2024Quote: ... slides were washed in PBS and incubated in 5 μg mL-1 4’,6-diamidino-2-phenylindole (DAPI) (Sigma Aldrich) in PBS (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... 132 mM NaCl, 6 mM KCL, 1 mM CaCL2, 1 mM MgSO4, 1.2 mM K2HPO4, 5 mM glucose, Sigma-Aldrich, and 0.4% (w/v) human serum albumin ...
-
bioRxiv - Biochemistry 2019Quote: ... The plate was developed with 2,2’-Azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (Sigma), and analysed by spectrophotometry at 405 nm ...
-
bioRxiv - Cell Biology 2021Quote: ... 50 μL of azino-bis-3-ethylbenthiazoline-6-sulfonic acid (ABTS liquid substrate; Sigma) was added and incubated in the dark at room temperature for 20 minutes and 50 μL of 1% SDS was used to stop the reaction ...
-
bioRxiv - Biochemistry 2020Quote: ... TsFpn was then concentrated to 3-6 mg/ml (Amicon 50 kDa cutoff, Millipore) and loaded onto a size-exclusion column (SRT-3C SEC-300 ...
-
bioRxiv - Microbiology 2020Quote: ... 100 μL of azino-bis-3-ethylbenthiazoline-6-sulfonic acid (ABTS liquid substrate; Sigma) was added and incubated in the dark at room temperature and 100 μL of 1% SDS was used to stop the reaction ...
-
bioRxiv - Microbiology 2020Quote: ... 50 μL of azino-bis-3-ethylbenthiazoline-6-sulfonic acid (ABTS liquid substrate; Sigma) was added and incubated in the dark at RT and 50 μL of 1% SDS was used to stop the reaction ...
-
bioRxiv - Neuroscience 2021Quote: ... and 6-chloro-1,2-benzisoxazol-3(2H)-one (CBIO) were purchased from Sigma Aldrich. Phorbol 12-myristate 13-acetate was purchased from Cayman Chemical ...
-
bioRxiv - Immunology 2024Quote: ... 6 uM pargyline and 50 uM (-)-epigallocatechin-3-gallate (EGCG) (all from Sigma Aldrich). For metabolic pathway analysis ...
-
bioRxiv - Microbiology 2023Quote: ... 540-69-2] (pH 3, adjusted with formic acid [Sigma Aldrich, 64-18-6]) and solvent B was acetonitrile [Sigma Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... 3 mM Na+pyruvate (Sigma-Aldrich; St. Louis, MO; CAS No. 113-24-6), 2 mM N-acetyl-L-cysteine (Sigma-Aldrich ...
-
bioRxiv - Plant Biology 2020Quote: ... 150 µM 3′,5′-Dimethoxy-4′-hydroxyacetophenone (acetosyringone; SIGMA, USA) at a 23.7×108 cfu/ml (OD600=0.75 ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 × 5 minutes each and were mounted using Fluorosave (Millipore) before imaging ...
-
bioRxiv - Immunology 2021Quote: ... siRNA-TDP-43 D: 5’-GAAACAAUCAAGGUAGUAA[dT][dT]-3’ (Sigma)4 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 100 µM acetosyringone (3′,5′-dimethoxy-4′-hydroxyacetophenone, Sigma D134406), and incubated for 6h at 28°C at 150 rpm.
-
bioRxiv - Microbiology 2021Quote: ... 5 × 10−3 g/L human insulin (Sigma Aldrich, USA), 5 × 10−5 M hydrocortisone (Upjohn Laboratories SERB ...
-
bioRxiv - Microbiology 2020Quote: ... Reverse Primer 5’-TGGTTGAGCACAGGGTACTT-3’] were synthesized by Sigma-Aldrich, USA ...
-
bioRxiv - Plant Biology 2020Quote: ... 200 μM 3′,5′-Dimethoxy-4′-hydroxyacetophenone (acetosyringone) (SIGMA, USA) carrying the corresponding binary plasmids (Table 1) ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM MgCl2 and phosphatase (phosphatase inhibitor cocktail 3, Sigma) and protease inhibitors (EDTA free cOmplete™ protease inhibitors ...
-
bioRxiv - Immunology 2019Quote: ... and 3-5 μg/ml Concanavalin A (ConA) (Sigma Aldrich) in tissue-culture treated 24-well plates.
-
bioRxiv - Biochemistry 2021Quote: ... 5-Bromo-4-Chloro-3-Indolyl-phosphate (BCIP, Sigma B8503) was used as the chromogenic substrate.
-
bioRxiv - Cell Biology 2021Quote: ... (3) TGFβ2 (5 ng/ml) + GsMTx4 (500 nM; Sigma-Aldrich), or (4 ...
-
bioRxiv - Physiology 2022Quote: ... 3 nM 3,3’,5-Triiodo-L-thyronine sodium salt (Sigma), 10 ng/ml EGF (Sigma) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The membranes were blocked in 3-5% skimmed milk (Sigma) dissolved in Tris buffered saline + 0.2% v/v Tween-20 (TBST) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 2’-O-dibutyryladenosine 3:5-cyclic monophosphate (dbcAMP; Sigma-Aldrich), and 0.1 mM 3-isobutyl-1-methyl xanthine (IBMX ...
-
bioRxiv - Cell Biology 2023Quote: ... 5-Bromo-4-chloro-3-indolyl β-D-galactopyranoside (Sigma) was used at a final concentration of 1mg/ml ...
-
bioRxiv - Plant Biology 2023Quote: ... and BCIP (5-bromo-4-chloro-3-indolyl-phosphate; Sigma).
-
bioRxiv - Immunology 2024Quote: ... reverse primer (5’-3’): GACGGTGCCATGGAATTTGC) and purchased from Sigma-Aldrich. RT-qPCR was performed with gene-targeted primers using TB Green Premix Ex Taq II (Tli RNase H Plus ...
-
bioRxiv - Biochemistry 2020Quote: A reference standard of 38 fatty acid methyl ester standards was prepared by mixing a purchased 37 fatty acid methyl ester (FAME) standard (Restek, Bellefonte, PA, USA) and 450 μM methyl-nonadecanoate in MTBE (Sigma Aldrich) at a 1:9 ratio ...
-
bioRxiv - Cell Biology 2021Quote: Labeling reagents XTT (sodium 3’-[1-(phenylaminocarbonyl)- 3,4-tetrazolium]-bis (4-methoxy6-nitro) benzene sulfonic acid hydrate) and PMS (N-methyl dibenzopyrazine methyl sulfate) were purchased from Sigma-Aldrich. Assay was performed according to protocol in Cell proliferation kit II (XTT ...
-
bioRxiv - Microbiology 2024Quote: ... Fatty acids were identified according to their retention times and their absolute amounts in each sample (nmol g−1 dry weight soil) were calculated using commercially available fatty acid methyl ester and bacterial fatty acid methyl ester mixes (Sigma-Aldrich).
-
bioRxiv - Immunology 2024Quote: ... The minced tumor tissue was transferred to a 6-well plate containing 3 mL/well of tumor digestion media (NK cell media + 1 mg/mL collagenase IV (Sigma, cat. C5138) + 0.2 mg/mL DNAse I (Roche ...
-
bioRxiv - Genomics 2022Quote: The stable cell lines constantly expressing the minigenes were subjected to four time points (0, 3, 6, and 9 h) of post actinomycin D treatment (final concentration of 1 μg/mL; Sigma, no. A9415) treatment in three biological replicates ...
-
bioRxiv - Microbiology 2021Quote: ... and the sequences of the siRNAs targeting DDX42 were siDDX42-1: 5’-CAGAAUGCCUGGUUUCGGA-3’ (SASI_Hs01_00119846, Sigma-Aldrich®), siDDX42-2 ...
-
bioRxiv - Neuroscience 2022Quote: ... we delivered the Iκ-kinase inhibitor [5-(p-Fluorophenyl)-2-ureido]thiophene-3-carboxamide (TPCA-1; Sigma-Aldrich CAS 507475-17-4 ...
-
bioRxiv - Microbiology 2023Quote: ... 3 ×104 THP-1 cells were seeded and differentiated by the addition of 5 ng/ml PMA (Sigma) in complete RPMI media (Himedia ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were treated with 10 μM of the agonist N-[(3R)-1-Azabiciclo[2.2.2]oct-3-yl]furo[2,3-c]pyridine-5-carboxamide (PHA-543613, from Sigma, PZ0135) for 30 min ...
-
bioRxiv - Biochemistry 2020Quote: ... These were mounted in a drop of in 0.1 M phosphate buffer containing 1:1 of 2% methyl cellulose (Sigma-Aldrich) and 2.3 M sucrose on TEM grids with a carbon-coated Formvar film (Taab Laboratory Equipment Ltd) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 70nm Sections were picked up using a 1 :1 mixture of 2.3M sucrose and 2% methyl cellulose (cat# M-6385, Sigma-Aldrich) as a pick-up solution and sections were transferred to carbon and formvar coated mesh grids (cat# H100-Cu ...
-
bioRxiv - Developmental Biology 2021Quote: Treated or untreated embryos were anesthetized at desired stages with 0.02% tricaine and mounted in 5% methyl cellulose (Sigma, Cat M-6385) for observation ...
-
bioRxiv - Plant Biology 2022Quote: ... Individual plants of similar size were transferred onto BCDATG agar (4-5 per plate) supplemented with NaCl or methyl viologen (Sigma-Aldrich, 856177) and incubated at 22±1°C with a 16h:8h light:dark cycle ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 100 µM of the nonspecific nitric oxide synthase inhibitor Nω-Nitro-L-arginine methyl ester hydrochloride (L-NAME [Sigma Aldrich], n=5), or 1.0 mM P188 and 100 µM L-NAME (n=5) ...
-
bioRxiv - Microbiology 2023Quote: The small interfering RNAs (siRNAs) against NLRP3 (siNLRP3) (5’-UGCAAGAUCUCUCAGCAAA-3’) and the corresponding control siRNAs (siControl) (5’-UUCAAUAAAUUCUUGAGGU-5’) were synthesized from Sigma. The siGenome smart pool siRNAs and siON Target plus siRNAs were purchased from Dharmacon and are composed of a pool of four siRNAs ...