Labshake search
Citations for Millipore Sigma :
601 - 650 of 10000+ citations for 5 Benzyloxy pyrimidine 2 carbonitrile since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... the parasites were selected with 10 μM 5-fluoro-2-deoxyuridine (FUDR) (Sigma–Aldrich, Cat#F0503) for three passages ...
-
bioRxiv - Microbiology 2023Quote: ... 120mM Tris HCl pH=6.8 and 20% glycerol(v/v)) containing 5% 2-mercaptoethanol (Sigma-Aldrich). Samples were resolved on a 10% SDS-PAGE gel in 1 × Tris glycine SDS buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... Mouse monoclonal anti α-tubulin clone B-5-1-2 (Sigma-Aldrich, St. Louis, MO, USA) and anti-PABP [49] were used as loading controls ...
-
bioRxiv - Immunology 2024Quote: Mice were injected once intraperitoneally with 1 mg of 5-bromo-2’-deoxyuridine (BrdU, Sigma-Aldrich) and then fed with BrdU-containing water (0.8 mg/ml ...
-
bioRxiv - Neuroscience 2024Quote: ... Rock inhibitor was withdrawn and cell selection was started with (2–5 μg/mL) puromycin(Sigma). From day 3 to day 8 ...
-
bioRxiv - Microbiology 2024Quote: ... The primary antibodies used for immunoblotting included mouse anti-tubulin (B-5-1-2; Sigma-Aldrich).
-
bioRxiv - Biophysics 2024Quote: ... and anti-alpha tubulin primary antibodies (monoclonal mouse clones B-5-1-2 and DM1a, Sigma), revealed with donkey anti-mouse secondary antibodies conjugated to Alexa Fluor 555 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5 mL of the single cell suspension was then overlayed on 2 mL 30 % Percoll (Sigma) and centrifuged with disabled break at 600g for 8 minutes at 4 °C ...
-
bioRxiv - Cancer Biology 2024Quote: ... and anti-mitotic reagents (20 μM 5-fluoro-2-deoxyuridine and 20 μM uridine; Sigma Aldrich). A total of 10,000 cells were seeded into 12-well plate pre-coated with 100 μg/ml poly-D-lysine (Sigma Aldrich ...
-
bioRxiv - Molecular Biology 2024Quote: ... supplemented with 1:10000 dilution of anti-mouse alpha-Tubulin (Clone B-5-1-2; SIGMA) for 1 to 3 h at room temperature ...
-
bioRxiv - Biophysics 2024Quote: P.69T and variants (5 μM each) were digested with 2 μg/ml proteinase K (Sigma) for 24 h at room temperature in 50 mM TrisHCl pH8.8 ...
-
bioRxiv - Developmental Biology 2024Quote: ... Then the samples were immersed in 5% (V/V) H2O2 for 2 h (Sigma-Aldrich, H1009) for bleaching 35.
-
bioRxiv - Systems Biology 2024Quote: ... before being transferred to auxin plates supplemented with 5-Fluoro-2’-deoxyuridine (FUDR, Sigma-Aldrich, F0503) at a final concentration of 40 µM ...
-
bioRxiv - Cell Biology 2024Quote: ... and reduced with 5 mM tris(2-carboxyethyl)phosphine hydrochloride (TCEP, Sigma-Aldrich Cat No: C4706) for 30 minutes at room temperature ...
-
bioRxiv - Developmental Biology 2024Quote: ... rinsed again for 2 minutes then incubated 5 minutes in aqueous eosin Y (Sigma-Aldrich, HT110232). Sections were dehydrated then mounted with EuKitt (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2020Quote: ... nuclei were stained with DAPI (2 μg/ml, room temperature, 5 min, Sigma, St. Louis, Missouri, USA).
-
bioRxiv - Plant Biology 2022Quote: ... DSF supplementation was performed by adding with 5 μM of cis-11-methyl-2-dodecenoic acid (Sigma) to the media.
-
bioRxiv - Molecular Biology 2020Quote: ... 10% FCS and human fibroblast growth factor-2 (5 ng/mL, Sigma-Aldrich, St Louis, MO, USA) at 37 °C ...
-
bioRxiv - Physiology 2020Quote: ... 5 mM glucose and 2% BSA for two hours while treated with 1 μM isoproterenol (Sigma-Aldrich), 10 μM forskolin with 0.5 mM IBMX (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2020Quote: ... the sections were counterstained with DAPI (4′,6-diamidino-2-phenylindole dihydrochloride; 5 µg/ml, Sigma-Aldrich) at room temperature for 20 minutes.
-
bioRxiv - Microbiology 2021Quote: ... The minimal medium was supplemented with 5 mM 2-(N-morpholino) ethanesulfonic acid (Mes: Sigma Chemical Co.) adjusted to pH 6.4 with NaOH as buffer and 0.5% (w/v ...
-
bioRxiv - Microbiology 2021Quote: 20 μg of fraction 19 were reduced with 5 mM Tris(2-carboxyethyl)phosphine (646547, Sigma Aldrich) for 60 min at 65 °C ...
-
Observation of an α-synuclein liquid droplet state and its maturation into Lewy body-like assembliesbioRxiv - Molecular Biology 2020Quote: ... larvae were placed on nematode growth medium (NGM) plates containing 5-fluoro-2’deoxy-uridine (FUDR, Sigma) (75 μM ...
-
bioRxiv - Microbiology 2020Quote: ... Continuous culture was typically carried at 2-5%-hematocrit in RPMI-1640 (Sigma Aldrich, Cat. No. R6504) supplemented with HEPES ...
-
bioRxiv - Immunology 2022Quote: Total RNA was collected from cultured cells treated with 100 nM 5-aza-2⍰-deoxycytidine (decitabine; Sigma) or splenocytes from a naïve C57BL/6 mouse using NucleoSpin RNA Plus (Takara) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Samples were combined with NuPage LDS sample buffer 4x (#2083421) and 5% 2-Mercaptoethanol (Sigma Aldrich #M6250) and heated for 10 minutes at 70°C ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were mounted after 4′,6-diamidino-2-phenylindole (DAPI) staining (1:5 000, Sigma-Aldrich, USA). Confocal images were captured under 20× objective using A-1R Confocal Microscope (Nikon ...
-
bioRxiv - Developmental Biology 2022Quote: ... and (+−)-6-hydroxy-2,5,7,8- tetra- methylchromane-2-carboxylic acid (Trolox) (cat: 238813-5 G) were ordered from Sigma. Potassium chloride (cat ...
-
bioRxiv - Neuroscience 2021Quote: ... A CRISPR-Cas9 crRNA (5’- GAGGCCAAGATGAGTACTGAGG-3’) targeting exon 2 of Blvra was synthesized by Sigma Aldrich. A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... before fixation for 5 hrs in humid conditions at 37 °C in 1.4% / 2% formaldehyde (F8775 Sigma) / acrylamide (A4058 Sigma) ...
-
bioRxiv - Cancer Biology 2021Quote: Polyacrylamide (PA) gels of varying stiffness (0.5, 2, and 5 kPa) were fabricated on 3-APTMS (Sigma) functionalized glass coverslips by combining 40% acrylamide and 2% bis-acrylamide in specific ratios as described previously [81] ...
-
bioRxiv - Neuroscience 2020Quote: All birds received intramuscular injections of 5-Bromo-2’-deoxyuridine (BrdU; 74 μg/g, pH 7.4, Sigma) 3x/day for three days to label mitotically active cells ...
-
bioRxiv - Immunology 2021Quote: ... in the presence of 4-amino-5 methylamino-2’ s,7’-difluorofluorescein (DAF-FM) diacetate (Sigma, D1946). DAF fluorescence intensities were measured every 5 minutes for a total of 60 minutes using a SpectraMax iD3 (Molecular Devices) ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were then blocked for 2☐h in 5% bovine serum albumin (BSA, Sigma-Aldrich, A7906) in 0.01☐M PBS and 0.3% Triton X-100 (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... The parasites (ring stage; 2-4 hpi) were tightly synchronized with 5% (v/v) D-sorbitol (Sigma) and then monitored by Giemsa staining of methanol-fixed blood smears ...
-
bioRxiv - Genomics 2020Quote: ... the cells were spun down and moved to “Phase 2” IMDM media containing 5% human serum (Sigma), 330µg/mL transferrin ...
-
bioRxiv - Cancer Biology 2022Quote: ... S-phase populations were identified by incorporation of 10 μM 5-ethynyl-2’-deoxyuridine (EdU; Sigma-Aldrich) 45 min before fixation ...
-
bioRxiv - Cell Biology 2022Quote: ... A small piece of frozen BAT (2 – 5 mg) was transferred into a BeadBug tube (Sigma Aldrich) containing 1.0 mm zirconium beads (Merck ...
-
bioRxiv - Developmental Biology 2022Quote: Time-pregnant mice were injected with 5-bromo-2’deoxyuridine (BrdU) (50 mg/kg body weight, Sigma) 1 h before the harvest of embryos ...
-
bioRxiv - Neuroscience 2023Quote: Mice were injected intraperitoneally (i.p.) once with 150 mg/kg of 5-bromo-2′-deoxyuridine (BrdU; Sigma) 24 hours before sacrifice for cell proliferation assessment ...
-
bioRxiv - Neuroscience 2022Quote: ... and ≥99% 4-methyl-3-heptanol and 99% 6-methyl-5-hepten-2-one from Sigma-Aldrich (Item numbers M48309 and M48805-100ML ...
-
bioRxiv - Physiology 2022Quote: ... they were picked onto NGM treatment plates containing 49.5 μM 5-fluoro-2’-deoxyuridine (FUDR, Sigma F0503) to prevent progeny production and either α-KB or vehicle (water ...
-
bioRxiv - Microbiology 2024Quote: ... and Tuba (5’-CAGAATCATGATGAGGCCAtt-3’. These siRNAs were obtained from Sigma-Aldrich (Dyn2-2 and Dyn2-3) or Qiagen (Tuba ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were labeled with 25 µM 5-Chloro-2’-deoxyuridine (CldU, Sigma-Aldrich, CAS 50-90-8) for 30 min ...
-
bioRxiv - Developmental Biology 2024Quote: ... followed by a second 20-minute pulse with 250 µM 5-chloro-2-deoxyuridine (C6891, Sigma-Aldrich). The labeled cells were then washed twice with ice-cold 1X PBS ...
-
bioRxiv - Physiology 2023Quote: ... The NC membrane was initially blocked with 5% nonfat milk and 2% BSA (A4503, Sigma (v/v)) in Tris buffered saline with 0.1% Tween 20 (93773 ...
-
bioRxiv - Physiology 2023Quote: ... The NC membrane was initially blocked with 5% nonfat milk and 2% BSA (A4503, Sigma (v/v)) in tris buffered saline with 0.1% Tween 20 (93773 ...
-
Activation of glucocorticoid receptor signaling inhibits KSHV-induced inflammation and tumorigenesisbioRxiv - Cancer Biology 2023Quote: ... Cell cycle was examined by flow cytometry following 5′-bromo-2′-deoxyuridine (BrdU) labeling (BrdU: Sigma-Aldrich, MB5002 ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.5 μl of 30 mM D-(-)-2-Amino-5-Phosphonopentanoic acid (D-APV, Sigma Aldrich, Cat #: A8054) dissolved in ACSF (Wang ...
-
bioRxiv - Neuroscience 2023Quote: ... short term neighbor rescue experiment NSCs were incubated with 20 µM 5-bromo-2’-deoxyuridine (BrdU) (Sigma) for 2 hours then fixed with 4% paraformaldehyde prior to immunohistochemical processing ...