Labshake search
Citations for Millipore Sigma :
551 - 600 of 10000+ citations for 5 Benzyloxy pyrimidine 2 carbonitrile since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... and freshly added 10 mM ROCK inhibitor and 2 mg/ml Doxycycline (Sigma, D9891-5) to initiate differentiation ...
-
bioRxiv - Immunology 2024Quote: ... Samples were blocked with permeabilization/block buffer (1X PBS, 5% BSA, 2% Triton-X (Sigma)) for 1 hr at RT ...
-
bioRxiv - Biochemistry 2024Quote: ... After 2 days incubating with 5 μM ROCK Inhibitor (Y-27632, RI, from Merck Millipore), 40 μM TGF-β inhibitor (SB 431524 ...
-
bioRxiv - Neuroscience 2024Quote: ... Proteins were reduced with 5 mM tris(2-carboxyethyl)phosphine hydrochloride (TCEP, Sigma-Aldrich 68957) and alkylated with 10 mM chloroacetamide (Sigma-Aldrich 22790) ...
-
bioRxiv - Neuroscience 2024Quote: ... a mix of 37 mM uridine and 27 mM 5-fluoro-2-deoxyuridine (Sigma Aldrich) was added to the cultures.
-
bioRxiv - Molecular Biology 2024Quote: ... pH 8.5 and reduced with 5 mM Tris(2-carboxyethyl)phosphine hydrochloride (Sigma-Aldrich, C4706) and alkylated with 55 mM 2-Chloroacetamide (Sigma-Aldrich ...
-
bioRxiv - Plant Biology 2024Quote: ... 5 mM sodium ascorbate) on ice and filtered through 2 layers of Miracloth (Merck Millipore). Intact chloroplasts were collected from a band at the interface between the 40 % (v/v ...
-
bioRxiv - Neuroscience 2024Quote: Proliferating cells were labelled with the thymidine analogue 5-ethynyl-2′-deoxyuridine (EdU) (Sigma; 900584) at a 1 µM concentration that was added to the culture media 1 h before fixation ...
-
bioRxiv - Bioengineering 2024Quote: ... 2 mL of growth media supplemented with 5 mg/mL 6-aminocaproic acid (Sigma-Aldrich) was added to each well ...
-
bioRxiv - Cancer Biology 2024Quote: ... pH 8.5 with 5 mM tris (2-carboxyethyl)phosphine hydrochloride (Sigma-Aldrich Cat No: C4706) for 30 min at 35°C ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 hemisphere of each mouse brain without cerebellum and olfactory bulbs was placed in FACS buffer (1x DPBS, 2% FCS and 2 mM EDTA) + 5 μM Actinomycin D (ActD, Sigma, Cat#A1410-5MG) for transcriptomics ...
-
bioRxiv - Microbiology 2024Quote: ... zebrafish larvae were injected at 2 dpf with a 1:5 dilution of LC in PBS + 2% phenol red (Millipore Sigma, Cat # P0290) in the caudal vein ...
-
bioRxiv - Immunology 2024Quote: ... the allosteric FFA2R modulator Cmp58 ((S)-2-(4-chlorophenyl)-3,3-dimethyl-N-(5-phenylthiazol-2-yl)butanamide) and adenosine 5′-thriphosphate disodium salt hydrate (ATP) were from Sigma-Aldrich (Merck, Burlington, MA, USA). The FFA2R antagonist CATPB ((S)-3-(2-(3-Chlorophenyl)acetamido)-4-(4-(trifluoromethyl ...
-
bioRxiv - Cancer Biology 2020Quote: ... and Hs 766T were plated at a density of 2×104 cells/cm2 and were treated for six days with 100 μM 5-aza-2’deoxycytidine (Sigma Aldrich, St. Louis, MO) or for 24 hours with 50 nM Trichostatin A (Sigma Aldrich ...
-
bioRxiv - Molecular Biology 2024Quote: ... Three different replicas of the irradiated cell lines and the negative control were incubated at 37°C in a 5% CO2 atmosphere for 48 h with the thymine analog 5-bromo-2’-deoxyuridine (BrdU, Sigma-Aldrich, St. Louis, MI, USA). Colcemid was added 24 h before the extraction ...
-
bioRxiv - Cancer Biology 2021Quote: ... a sterile β-mercaptoethanol solution was prepared (5 μl of 2-mercaptoethanol (Sigma-Aldrich, Munich, Germany)) in 8.45 ml of PBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... Brdu-ChIP was performed after addition of 20 μM BrdU (5-bromo-2′-deoxyuridine, Sigma Aldrich) directly to HeLa culture medium for 1 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... for 3.5 minutes at 5 μL/min with 2% Acetonitrile MS grade (Sigma Aldrich, Cat# 1207802), 0.1% formic acid (FA ...
-
bioRxiv - Microbiology 2020Quote: ... For this, NHS-CF555 (5 µl, 2 mM) in dimethyl sulfoxide (DMSO; Sigma-Aldrich Co., LLC) was added to AgNP (500 µl) ...
-
bioRxiv - Biochemistry 2020Quote: ... The sequence of the biotinylated 2’-deoxyoligonucleotide is 5’ – (Biotin) AAATGGTGCCGAAACCCGGGATCGAACCAGGGT – 3’ (Sigma Aldrich, Munich, Germany)
-
bioRxiv - Neuroscience 2021Quote: ... mouse α-tubulin clone B-5-1-2 (1:1000; Sigma Aldrich, San Luis, MO, U.S.). For immunofluorescence primary antibodies were labeled with Alexa-conjugated secondary antibodies Alexa 488 ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 -5 mg of MeHA was dissolved in 1 mL Deuterium oxide (D2O) (Sigma Aldrich, 151882) and then tested with 300MHz 1HNMR with 10 ms time scale ...
-
bioRxiv - Microbiology 2020Quote: ... Senescence was induced by treating cells with 100 µM 5-Bromo-2’-deoxyuridine (Sigma Aldrich, USA) for 48 hours ...
-
bioRxiv - Systems Biology 2021Quote: ... the proteins the samples were reduced with 5 mM Tris(2-carboxyethyl)phosphine (TCEP; Sigma-Aldrich) for 20 minutes in 37 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10 µM of 5’heyxynyl-dT50 (IDT) were mixed with 2 mM of CuSO4 (SIGMA, C1297) and DDW ...
-
bioRxiv - Microbiology 2022Quote: ... Blocking was performed at room temperature for 2 hours using 5% skimmed milk (70166, Sigma-Aldrich) in 1X PBS containing 0.05% Tween 20 (P1379 ...
-
bioRxiv - Immunology 2022Quote: Neonatal and juvenile mice received daily intraperitoneal injections of 5-aza-2’-deoxycytidine (decitabine, DAC; Sigma) 1 mg/kg (7 ...
-
bioRxiv - Genetics 2020Quote: ... Animals were then placed on NGM plates containing 10 µM 5-Fluoro-2′-deoxyuridine (FUDR, Sigma) to inhibit the development of progeny ...
-
bioRxiv - Cell Biology 2021Quote: ... worms were subsequently mounted on 2% agarose pads and anesthetized with 5 mM tetramisole (Sigma-Aldrich) for observation under a fluorescence microscope.
-
bioRxiv - Immunology 2020Quote: Mice were injected intraperitoneally with 0.5 mg 5-ethynyl-2’-deoxyuridine (EdU, Invitrogen or Sigma-Aldrich). For pulse experiments ...
-
bioRxiv - Microbiology 2021Quote: ... MNZ (5 uM for 24 hrs) or GSNO (350 μM for 2 hrs) (Sigma-Aldrich, USA) was determined by the eosin dye exclusion method [31].
-
bioRxiv - Neuroscience 2023Quote: ... Dissociated cells were treated with 1 μM of 5-fluoro-2′-deoxyuridine (Sigma, cat. no. F0503) for the first 24 hours to remove presumptive progenitor and/or glial cells ...
-
bioRxiv - Neuroscience 2022Quote: ... samples were incubated for 5 min with a 4’,6-diamidino-2-phenylindole (DAPI) solution (Sigma) to stain cell nuclei ...
-
bioRxiv - Cell Biology 2023Quote: ... RPMI media containing 5% FBS and 2% w/v bovine serum albumin (BSA; Sigma-Aldrich #A6003). FA mixtures were gently rocked for 1 hour at 37°C to aid conjugation of the fatty acids to BSA ...
-
bioRxiv - Molecular Biology 2023Quote: ... Exponentially growing RPE-1 cells were pulse-labeled with CldU (5-Chloro-2’-deoxyuridine, Millipore Sigma) and IdU (5-Iodo-2’-deoxyuridine ...
-
bioRxiv - Cell Biology 2023Quote: ... Bottom coverslips are activated with a 2% 3-Aminopropyltrimethoxysilane (3-APTMS) (Sigma Aldrich 13822-56-5) in 96% ethanol solution for 5 minutes and washed with 70% ethanol ...
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3 μg/mL 5-fluoro-2′-deoxyuridine + 7 μg/mL uridine (FRDU, F0503, Sigma-Aldrich). Cultured cells were then kept at 37°C and 5% CO2 in an incubator with culture media changes at 48 hours with supplemented media and NGF and FRDU until further experimentation.
-
bioRxiv - Immunology 2023Quote: ... after treatment for 2 h at 37°C with 5 μg/ml brefeldin A (Sigma-Aldrich). Cells were washed and fixed with BD cell fix diluted 4X in PBS ...
-
bioRxiv - Neuroscience 2024Quote: A mix of endotoxin-free plasmid preparation (2-5 mg/mL) and 0.5% Fast Green (Sigma) mixture was injected using a Picospritzer III (Parker ...
-
bioRxiv - Neuroscience 2023Quote: ... we injected 5-bromo-2′-deoxyuridine (BrdU, 10 mg/ml in saline, 100 mg/kg, Sigma) through an intraperitoneal (i.p. ...
-
bioRxiv - Immunology 2023Quote: ... inactive dephosphorylated A3 (2’,5’-A3) 53 or with poly(I):poly(C) (Millipore Sigma, #528906) at the concentrations indicated in figure legends with Lipofectamine 2000 (Invivogen ...
-
bioRxiv - Physiology 2024Quote: ... samples were incubated with 5 µg/mL 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI, Sigma-Aldrich) in PBS ...
-
bioRxiv - Microbiology 2023Quote: ... the parasites were selected with 10 μM 5-fluoro-2-deoxyuridine (FUDR) (Sigma–Aldrich, Cat#F0503) for three passages ...
-
bioRxiv - Microbiology 2023Quote: ... 120mM Tris HCl pH=6.8 and 20% glycerol(v/v)) containing 5% 2-mercaptoethanol (Sigma-Aldrich). Samples were resolved on a 10% SDS-PAGE gel in 1 × Tris glycine SDS buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... Mouse monoclonal anti α-tubulin clone B-5-1-2 (Sigma-Aldrich, St. Louis, MO, USA) and anti-PABP [49] were used as loading controls ...
-
bioRxiv - Microbiology 2024Quote: ... 3-(2pyridyl)-5,6-bis(2-(5-furylsulfonic acid))-1,2,4-triazin (Sigma-Aldrich, St Louis, MO, USA) (27) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Ethylene glycol-bis(2-aminoethylether)-N,N,N′,N′-tetraacetic acid (EGTA) 5 mM (Sigma E3889) was added to quench the reaction ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli were also grown in 2 mL Overnight Express Instant TB media (Sigma Aldrich, 71491-5) with added 100 μg/mL ampicillin ...
-
bioRxiv - Bioengineering 2022Quote: ... cells were incubated for 2 h at 37 °C and 5% CO2 with MTT (Sigma-Aldrich) dissolved in DMEM media without phenol red ...