Labshake search
Citations for Millipore Sigma :
551 - 600 of 7146 citations for Recombinant Human Interleukin 6 Receptor His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... the protein was eluted in a gradient of His-AC washing buffer and His-AC elution buffer (both supplemented with 0.1% Tween-20 (Sigma Aldrich), 0.1% NP-40 (Thermo Fischer Scientific) ...
-
bioRxiv - Plant Biology 2024Quote: ... His–NFR1CD–Myc or His–NFR1CD–K351E–Myc and NopT–FLAG–His were co–expressed by using Duet expressing vectors (Novagen) with 0.5 mM IPTG at 28°C for 18 h ...
-
bioRxiv - Cell Biology 2019Quote: Undifferentiated SGBS cells were plated at 50 % confluence in 6-well plates and infected with commercial lentiviral particles targeting either human ABCG1 (TRCN0000420907; Sigma) (TAGGAAGATGTAGGCAGATTG ...
-
bioRxiv - Developmental Biology 2023Quote: ... Four- to five-week-old C57Bl/6 females were superovulated and MII oocytes collected in fertilisation media (Human Tubal Fluid (HTF, MR-070, Sigma) containing 4 mg/ml BSA and 25mM L-Glutathione 1 (GSH)) ...
-
bioRxiv - Microbiology 2020Quote: ... as a His-tag fusion in pET28b (Novagen). Cells were grown in Terrific-Broth at 37°C to an OD600 = 1.2 and after 15 min at 4°C induced with 1 mM isopropyl β-d-thiogalactoside ...
-
bioRxiv - Microbiology 2019Quote: ... Proteins were detected using anti-His-HRP (Sigma) and anti-FLAG-HRP (Sigma ...
-
bioRxiv - Plant Biology 2021Quote: ... -His with or without 3-AT (Sigma-Aldrich).
-
bioRxiv - Pathology 2021Quote: ... cloned into a pET28a His-tag vector (Novagen) and expressed in E ...
-
bioRxiv - Microbiology 2020Quote: ... Mouse anti-His antibody (1:12000) (Sigma-Aldrich) and biotinylated PNA (1:6000 ...
-
bioRxiv - Biophysics 2020Quote: ... His-purifying resin was from Novagen (Darmstadt, Germany). Bis-(sulfosuccinimidyl ...
-
bioRxiv - Cell Biology 2021Quote: ... and Anti-His(1:3000) antibody(Sigma #H1029).HRP conjugated mouse IgG was used at 1:4000 dilution(Sigma #A3673 ...
-
bioRxiv - Biochemistry 2021Quote: ... anti-His (Sigma H1029; 1:3000 for IB), anti-Hsp70 (Abcam ab47455 ...
-
bioRxiv - Plant Biology 2022Quote: ... followed by blotting using Anti-His (SAB4301134, Sigma) and Anti-GST antibody (ab9085 ...
-
bioRxiv - Genomics 2023Quote: ... with 10% heat-inactivated (HI) FBS (Sigma F0926). Vero/hSLAM cells were a kind gift from Dr ...
-
bioRxiv - Systems Biology 2023Quote: ... MCF7 in DMEM-Hi Glucose medium (Sigma-Aldrich) HCC1937 and ZR-75-1 in RPMI 1640 media (Gibco) ...
-
bioRxiv - Neuroscience 2024Quote: ... supplemented with 10% HI-FBS (Sigma-Aldrich, #12306C), 1% GlutaMAX (200 mM ...
-
bioRxiv - Neuroscience 2024Quote: ... supplemented with 10% HI-FBS (Sigma-Aldrich, #12306C), 1% GlutaMAX (200 mM ...
-
bioRxiv - Neuroscience 2024Quote: ... supplemented with 10% HI-FBS (Sigma-Aldrich, #12306C), 2% GlutaMAX (200 mM ...
-
bioRxiv - Biochemistry 2024Quote: ... An anti-His-primary antibody (Sigma, 1:2,000) was incubated with the protein-treated lipid strips to detect Jps1 bound via its C-terminal His-tag ...
-
bioRxiv - Cell Biology 2024Quote: ... +10% HI FBS(Sigma Aldrich, cat#F4135-500ML) + penicillin/streptomycin (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... and recombinant chondriotinase ABC (Sigma, C3667) was treated at 25 mU/mL ...
-
bioRxiv - Cancer Biology 2021Quote: ... Recombinant active AMPK (Millipore, 14-840) was added and incubated for 30 min at 30°C ...
-
bioRxiv - Microbiology 2019Quote: ... Recombinant IFNα was purchased from Sigma (Interferon-αA/D human Cat ...
-
bioRxiv - Developmental Biology 2022Quote: ... and Recombinant mouse LIF (Sigma, #ESG1107). Additionally ...
-
bioRxiv - Immunology 2021Quote: ... Recombinant purified Angiotensin II (Sigma – A9525) at 1 μM with 2-fold serial dilutions ...
-
bioRxiv - Immunology 2022Quote: ... recombinant complement component C3 (Millipore Sigma), recombinant CD4 (Sigma Aldrich ...
-
bioRxiv - Bioengineering 2022Quote: ... recombinant leukemia inhibitory factor (SRP3316; Sigma), growth hormone (869008 ...
-
bioRxiv - Neuroscience 2023Quote: ... and/or recombinant Fibronectin (Sigma-Aldrich) were applied as described using a range of concentrations (μg/ml).
-
bioRxiv - Biophysics 2023Quote: ... superoxide dismutase (bovine SOD, recombinant, Sigma) was added from a ≥50,000 U/mL stock prepared in assay buffer ...
-
bioRxiv - Cancer Biology 2023Quote: BG4 recombinant antibody (Sigma Aldrich MABE917)- ChIP
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 100 mIU/ml recombinant hCG (Sigma), and 10 mg/ml of human serum albumin (Sage) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1000U/ml ESGro recombinant LIF (Millipore), 1uM PD0325901 (R&D Systems) ...
-
bioRxiv - Microbiology 2021Quote: ... and extensively dialysed against HEPES-buffered saline and their level of expression determined by ELISA using a mouse monoclonal anti-His antibody (His-Tag mAb, EMD Millipore) as primary antibody and a goat anti-mouse alkaline phosphatase-conjugated secondary (Bethyl).
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... thereafter referred to as Mpp75Aa1.1-His) or without the C-terminal His tag (thereafter referred as Mpp75Aa1.1) was cloned into a pET24a vector (Novagen, Madison, WI) and expressed in Rosetta 2 (DE3 ...
-
bioRxiv - Cell Biology 2022Quote: ... and extensively dialysed against HBS and their level of expression determined by ELISA using a mouse monoclonal anti-His antibody (His-Tag monoclonal antibody, 70796, EMD Millipore) as primary antibody and a goat anti-mouse alkaline phosphatase-conjugated secondary (A3562 ...
-
bioRxiv - Neuroscience 2021Quote: ... and the GABA-B receptor agonist baclofen (Sigma Aldrich GmbH, Munich, Germany) were dissolved together in saline at a dose of 20ng/μl (muscimol ...
-
bioRxiv - Immunology 2021Quote: ... Sera were pre-treated with receptor destroying enzyme (RDE) (Sigma-Aldrich, C8772) and two-fold serially diluted ...
-
bioRxiv - Neuroscience 2019Quote: ... γ-aminobutyric acid B (GABAB) receptors with CGP5243 (25 µM; Sigma, Australia), phasic GABAA receptors with SR95531 (0.5 µM ...
-
bioRxiv - Neuroscience 2020Quote: The GABAA receptor agonist muscimol hydrobromide (Sigma-Aldrich, St. Louis, MO, USA) and antagonist (+)-bicuculline (Selleck ...
-
bioRxiv - Cancer Biology 2019Quote: ... Anti-Interferon-α/β Receptor Chain 2 Antibody (IFNA2, clone MAB1155; Millipore) and its corresponding isotype (Mouse IgG2a ...
-
bioRxiv - Neuroscience 2020Quote: ... the pan-glutamate receptor antagonist kynurenic acid (Sigma, 40mM, 8.5-9 pH) was filled in one barrel of the glass electrode and microointophoretically applied to the recording site ...
-
bioRxiv - Biochemistry 2021Quote: ... an angiotensin II receptor blocker (Arb; 10 μM for 24h; Sigma-Aldrich), or their combination for 24 h ...
-
bioRxiv - Physiology 2020Quote: ... p-Insulin Receptor Antibody(p-Thy1162/1163) (Calbiochem 407707 or Sigma I1783), phospho-CaM KinaseII (Cell Signaling #12716) ...
-
bioRxiv - Microbiology 2019Quote: ... or in response to muscarinic receptor stimulation with 100 µM carbachol (Sigma). The difference between basal Isc and peak Isc recorded after veratridine or carbachol addition was measured (ΔIsc ...
-
bioRxiv - Cancer Biology 2021Quote: ... as well as GABA-A receptor antagonists like Bicuculline methbromide (Sigma #B7561) and Picrotoxin (Sigma #P1675) ...
-
bioRxiv - Microbiology 2021Quote: ... Soluble receptor expression was induced by adding 1 μg/ml doxycycline (Sigma) to the cells the day before the assay ...
-
bioRxiv - Molecular Biology 2020Quote: ... The GABAB receptor was concentrated in a 100-kDa cutoff Vivaspin (Millipore) filter and run on a Superose™ 6 Increase column (GE Healthcare).
-
bioRxiv - Bioengineering 2020Quote: Ready-to-Assay Platelet Activating Factor Receptor Cells (Millipore Sigma, Burlington, MA) (Chem-1 host cells overexpressing PAFR GPCR ...
-
bioRxiv - Neuroscience 2021Quote: ... Rabbit anti-mu opioid receptor (MOR) antibody (1:1000; EMD Millipore: AB5511) was applied at 4°C in 1x PBS containing 0.25% Triton-X-100 (PBS-Tx ...
-
bioRxiv - Cell Biology 2022Quote: ... RyR receptor (tetracaine) or gap junctions [carbennoxolone (CBX)] were from Sigma-Aldrich.