Labshake search
Citations for Millipore Sigma :
5851 - 5900 of 10000+ citations for 6 PHENYL 1 3 DIHYDRO INDOL 2 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... Samples were then washed with lysis buffer containing 0.1% DDM and incubated with lysis buffer containing 1% DDM and 3×Flag peptide (100 µg/ml, Sigma #F4799) overnight for elution ...
-
bioRxiv - Molecular Biology 2023Quote: ... Penicillin, Streptomycin, LIF and 2i (3 μM Gsk3 inhibitor CT-99021, 1 μM MEK inhibitor PD0325901) and Vitamin C (Sigma) at a final concentration of 100 μg/ml ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... collected on a fine nylon mesh and transferred to a well of a 12-well cell culture plate containing 3 mL of 1% sodium dodecyl sulfate (SDS, Sigma) to facilitate egg dispersion ...
-
bioRxiv - Microbiology 2023Quote: ... at 1:1000 dilution at room temperature for 1 hour followed by washes x 3 then staining with goat anti-rabbit HRP-conjugated antibody (Catalog #204903, Sigma) at 1:5,000 dilution at room temperature for 1 hour ...
-
bioRxiv - Genetics 2024Quote: ... 29 Starved HAP1 cells were washed twice with DPBS supplemented with 1% v/v Phosphatase Inhibitor Cocktail 3 (Sigma #P0044) before trypsinization with trypLE (trypLE ...
-
bioRxiv - Developmental Biology 2024Quote: ... DNA was injected into the fourth ventricle at a final concentration of 1-3 µg/µl in addition to trace amounts of fast-green dye (Sigma). Three 50ms square waveform electrical pulses at 5V (E2 ...
-
bioRxiv - Plant Biology 2024Quote: ... spores were sown directly on plates supplemented with Indole-3-acetic acid (IAA; Alfa aeser) or 1-Naphthaleneacetic Acid (NAA, Sigma). Size measurements were done when plants reached sexual maturity (±6/7 days) ...
-
bioRxiv - Cell Biology 2024Quote: ... After the last EtOH wash the coverslips were incubated with methanol containing 5% acetic acid and 1% (3-Aminopropyl)triethoxysilane (Millipore-Sigma) overnight in a vacuum desiccation chamber in the dark ...
-
bioRxiv - Cancer Biology 2024Quote: HSJD-DIPG007 neurospheres were collected by centrifugation at 800 rpm for 3 min and dissociated into single cells with 1 mL Accutase (Sigma) for 5-10 minutes with occasional pipetting ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.3% Triton X-100 (PBST)) for 10 minutes and blocked for 1 hour with 10% normal donkey serum (Merck Millipore), 1% bovine serum albumin (BSA ...
-
bioRxiv - Biochemistry 2024Quote: ... were homogenized using a Polytron in 1 ml of 20 mM sodium acetate buffer containing 0.15 M NaCl and 1% Zwittergent 3-14 detergent (Millipore-Sigma 693017), pH 4.75 ...
-
bioRxiv - Neuroscience 2024Quote: ... and the samples were washed 3 times for 5 min in PBS and counter-stained with 1:1000 DAPI (D9542, Sigma) for 15 min ...
-
bioRxiv - Genetics 2024Quote: ... Then cells were washed with cold staining buffer to terminate reaction and incubated with rabbit complement sera (1:3 dilution, Cat. no. S7764, Sigma) for 30 min at RT ...
-
bioRxiv - Cell Biology 2024Quote: ... Fully grown oocytes were collected 48 hours after injection and placed in M2 medium containing 200 μM 3-isobutyl-1-methyl-xanthine (IBMX, Sigma) at 37°C ...
-
bioRxiv - Neuroscience 2024Quote: ... Samples were washed with distilled water 3×5min before being counterstained with DAPI solution diluted in PBS (1:50,000, Sigma-Aldrich) for 5 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... SC-His+3AT is minimal medium of SC-His supplemented with 3-aminotriazole (3-AT, 0.5mM, Sigma-Aldrich).
-
bioRxiv - Plant Biology 2019Quote: ... The transformants were then spotted on SD (-Trp -Leu -His) selection media containing 0.5/1mM 3-Amino-1,2,4-triazole (3-AT; Sigma, A8056). The positive interactors were then scored based on the stringency of the selection.
-
bioRxiv - Cell Biology 2021Quote: ... and mouse VPS35 (5’-GAUUCGAGAAGAUCUCCCA[dT][dT]-3’&5’-GUAAUGUUCUGGAUUAUAA[dT][dT]-3’) were purchased from Sigma-Aldrich. At 24 h after transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3-Amino-1,2,4-triazole (3-AT) (≥95% TLC) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Z-VAD-FMK ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 3 mg RBD protein in 3 mL PBS were mixed with equal-volume Freund’s complete adjuvant (Sigma-Aldrich) for priming ...
-
bioRxiv - Plant Biology 2023Quote: ... SD-WLH plates were supplemented with either 2.5 or 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich).
-
bioRxiv - Molecular Biology 2022Quote: ... SM and trunSM (tissue lysates) and 14-3-3 was performed using Immobilon Western chemiluminescent HRP substrate (Millipore) and an ImageQuant LAS 500 imager (Cytiva Life Sciences) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and HRP-conjugated Anti-Rabbit IgG Secondary Antibody) and R&D Systems/Minneapolis/MN (14-3-3-Sigma polyclonal goat IgG and HRP-conjugated Anti-Goat IgG Secondary Antibody) ...
-
bioRxiv - Plant Biology 2024Quote: ... Bromo-4-Chloro-3-Indolyl a-D-galactopyranoside (X-a-gal) and 10 mM 3-amino-1,2,4-triazole (3AT) (Sigma). The plates were imaged after 60-72 incubation at 28°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... were washed three times with 3 ml of water using Amicon Ultra-4 (3 kDa cut-off, Millipore) (centrifugation at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... The staining was revealed by exposure to 0.025% 3-3’-diaminobenzidine tetrahydrochloride (DAB, Sigma-Aldrich, St. Louis, MO), 0.01M Imidazole (Fisher Scientific ...
-
bioRxiv - Bioengineering 2023Quote: 3 dpf larvae were anesthetized in E3 medium containing 0.16 mg/mL Tricaine (ethyl 3-aminobenzoate; Sigma-Aldrich) and caudal fin transection was performed11 30 minutes prior to imaging ...
-
bioRxiv - Zoology 2023Quote: ... The concentrations used were 15.62 x 10-3 mg and 31.25 x 10-3 mg of capsaicin (CAS 4004-86-4 Sigma) per gram of body mass ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was isolated from testis tissues (3 WT versus 3 Clpp-null)) with TRI reagent (Sigma-Aldrich), and reverse transcription was done with SuperScript IV VILO Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... and filtered through a 3-kDa molecular filter (Amicon® Ultra Centrifugal Filter, 3 kDa MWCO, Millipore Sigma) at 4°C for 90 minutes to remove proteins ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’ – CACCGCCGCCTCCGCGCTTCCCCGA – 3’ PIEZO1_sgRNAact_TSS143 (guide 3): 5’ – CACCGAGGCCCCAACGCACCAGGGC – 3’ Modified U251 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; D5796, Sigma), supplemented with 10% foetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2024Quote: ... and the lipogenic medium was consistent with a 1:100 fatty acid (’F’ for short) composition of 1:1 oleic acid (Sigma, #O3008, 2 mol oleic acid/mole albumin) and linoleic acids (Sigma ...
-
bioRxiv - Cancer Biology 2019Quote: ... and HEK293T embryonic kidney cells [6] were grown in DMEM supplemented with 10% heat-inactivated FBS and 1% penicillin/streptomycin (Sigma Aldrich, St. Louis, MO). All cells were cultured at 37°C in 5% CO2 and 5% O2 ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... the mothers of the experimental animals returned to their home cages and were treated daily with a stainless steel feeding needle per oral gavage with either fluoxetine (10 mg/kg, n= 6 dams) or vehicle (Methylcellulose 1%, (Sigma, St. Louis, MO, USA), n=4 dams ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were disrupted by stirring for 1 hour in lysis buffer (100 mM Tris, 150 mM NaCl, 10% glycerol, 6 mg/mL lysozyme (Sigma, St. Louis, MO, USA), 2 mg/mL deoxycholic acid ...
-
bioRxiv - Bioengineering 2022Quote: ... Samples were stained by a PBS-based staining solution of 2 μM Calcein-AM from Thermo Fischer Scientific (Waltham, USA) for viable cells and 6 μM Ethidium homodimer-1 from Sigma Aldrich (St.Louis, MO, USA) for dead cells for 30 min at room temperature in the dark ...
-
bioRxiv - Developmental Biology 2022Quote: ... the sperm pellet was washed in IVF–TALP medium and a final concentration of 1 × 106 spermatozoa/mL was adjusted using IVF–TALP medium enriched with BSA (Sigma A8806; 6 mg/mL) and heparin (25 mg/mL).
-
bioRxiv - Biophysics 2021Quote: ... and (3-Aminopropyl) triethoxysilane (Sigma-Aldrich, A3648) in a v:v:v ratio of 100:5:3 ...
-
bioRxiv - Cancer Biology 2021Quote: ... were cultured on 3% polyHEMA (Sigma, P3932) coated 96 well plate for 48 h in a 37 °C humidified incubator with 5% carbon dioxide.
-
bioRxiv - Cell Biology 2019Quote: ... and 5’-UCGUGGAAAGUUUGCUGCAGGGAAA[dT][dT]-3’ (Sigma) (Doucet et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... 500 μM Indole-3-acetic acid (Sigma) was added 8 h after released ...
-
bioRxiv - Cell Biology 2020Quote: ... 1i-LIF (3 µM CHIR99021, Sigma-Aldrich, cat.no ...
-
bioRxiv - Cell Biology 2020Quote: ... – 50 μM in DMSO (3) Tunicamycin (Sigma) – 5 μg/ml in DMSO for 6hr (4 ...
-
bioRxiv - Immunology 2021Quote: ... or 3-MA (5 mM, Sigma-Aldrich), as indicated in the figure legends ...
-
bioRxiv - Genetics 2021Quote: ... Ni-NTA resin (EMD Millipore, 70691-3) was used to remove unreacted His-tagged nanobodies and His-tagged Sortase 5M enzyme ...
-
bioRxiv - Biochemistry 2020Quote: ... or 3) Lipopolysaccharide (LPS) (Sigma-Aldrich L3024) + interferon-γ (IFNγ ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 3 mM deferoxamine from Sigma (# BP987). Next ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3-Indoleacetic acid (Auxin, Sigma-Aldrich, I2886) was dissolved in 100% ethanol and diluted 400 times in the culture medium obtaining concentrations as indicated ...
-
bioRxiv - Developmental Biology 2020Quote: ... 3% Bovine Serum Albumin (BSA; Sigma, A2153), 0.5% Triton™X-100 (Sigma ...
-
bioRxiv - Developmental Biology 2020Quote: ... 3 % normal donkey serum (Sigma-Aldrich D9663), and 0.3 % Triton X-100 (Sigma 93443) ...